Description :
From Genome Similarity Track
Location :
Scaffold_4:414049- 417284
Transcript NameFunction/comments
Phyin_T30-4PITG_03082Outer Dynein Arm Light Chain 1

Sequence
3235 bases(100 bases per row)
GAGACGTAGGAGGACAGTCAGGACGGAATTTTGAAAAGAAGTCGATCGCAGGGACAAGTAATTTCCCCGAACTCAATGACCCTAGTGGTGAGAATATAGG
TTGGAGATGAAGAACTGATCTAATCACTTACTTGTCTTTGTCTGTAGCTCGCAAGCCAGTTCTGCGGACACCAGGAATTCACGAGCGGAAGACAAGTTCG
CGCTCTTACTCTCAAAATGTATGGACAAAGCAAACACTACCTGAAGAGCCATCACGACCAGTAAGCTCCCAAGCTCCAGTCAAGAGCTCCATTTTCACTG
CACCAGGGGCAAATCGAGCAGTGTCTGCTCAACCACAGTACTCAATACCTGTGGGAATAGTGTCACCATCCAGTCGAAGGCGACATGCTCTACCTCCACA
TCAGCAGCTTTATCACCAACGGAGACCCACAACTGACTCGGTGAGGATGCCAACGGATGCCGTACTCGAACATTCAAGCTAATTCTCACCTACTGCATGT
GGTTCAGCCTACAGAATTGCCAAGAAGTGATCGAGAGATGCCCATTAAGGAGTCACCGACACGACCTGCCACTGCTAGTGAAGTACGTGGAGCTGTGTTG
ACATTTTGACCAAACAAAACTGACCAACACTTCTGAAATCATGAAGATTCTAGACACCAGGTATCCAGGTTATCAGGGCAATGTACGAGGCTACGTCAGG
TACGAAGGAATGCTGCTACTGACCGCAACCGACGACAACTCATCGCGTCTCTGCTCTAGGAGGTCGCCTGAAGTGCTATCGACCTCGTTAGATCCATCCA
ATACTGTAAGTAAGCGTCATTGATTCATTTGCATGTAGCAGGCCCATAACGATTAAGTATTTCATGGACAATCAGGCACATGGGTGGCATCGTCACTCGT
ATTCGCTCCAAACTGGCACTGCTGATCCTGGTGGTCGGTATAGGACCCGGACAGAGTCAATGGTAGCTAATGACATGAAGTATACTGGTGCGGGAGAGCT
CCCCGTAAATGCTCCCAACCAAGAGGTACGCAGAGAAGGAGGATTCTTCTACAATAGCAAATGGTATGGCCGCTGACCTGACGAAGGATAGGTGCACTTT
GCAGTGACTGAGGAGATCCCAGGAGTCCCGATCGTCTATCGGAATCAAAAGGTAAGGCTGTCAAGTGCTCTCTCGCATGCGTTTCTAAAAACATGTTATG
ATCTGCTGCATATTAGACAAAAGTATCGAACCCCGAGCGACTAAATCTCGATCGTCGCAACCTGCCAGTGATTCCTCTTCTTGAAGGTGAGCAGATTCTT
CGCCTTCTCAATCTTCAAAATAATGTCATCCGGAGGATAGAGAATCTACTGGGACTGCCGAATCTAATTTTCCTCGACCTCTACAATAATCGCATCGAGG
TACGTGGTGTAGCACTTTTTGTCTCGGTCACTTGTCAACTTGATGACTTATTCTTCGTGAAGAAACTTGAGAATTTACACTTGGTGCCCAACCTACGAGT
GCTTATGATGGGGAAGAATCGACTTCGTACCATTGAGAATCTAGACTGCTTGAAAAAACTGGACGTGCTGGATCTACACAGGTACGTTGATGTCAACCTA
AAAAGTGGGCGTTTTCGACTAAATCTCTGGTCCTGAAGCAACGAAATTGAGCAGATGCAGAACCTGAACGAGCTCAAAGAGCTGCGTGTCTTAAATCTGG
GTGGGAATATGATCTCCGCAGTTGAAAACATTGACAAGTTGATGCTCCTCACCGAGCTGAATCTCCGACGAAATCGAATCCGTCGCATCGGAGCAATTGG
CACTCTGCCGTCACTTCTAAGACTTTTCTTGTCCAACAACAAGCTCGAGACATTCGAGTCGATAGCACCACTATTTCAGGTACGTGGATCAATCATGTCA
ACTGTCGATAGACACAGCAGCTAACAAAAGTGGCTGCGGGAGCTGCAGGTCTCGTCCATCAGCGAGTTGCGCTTGGACTCGAATGGAGTCTGCGCTCCTG
ACCAGATGGAGTATCGTGTGCGTATGATAAACAGCTTCCCGTCACTGAAGCATCTGGACCTCAAGCCTCTAAGTGATGCTGATAGAAAAGAAGCGTTGCT
ACGTGCCAATTCCCCCAGCAAAAGCGTTGATACAGCGGAAGCGGCTGCAAGAGTGCAAGCGATTTCATGCGTCAAGGCGAACTGGGAACGGCGTTCTCCA
GTGAGTAGCGAAGACTCGCGAGATTCGTCGTTTGTTTCGTCTTGGGAGCTCTCTACCAAAGCCGAGTTGAGTTCTCATGGCGGGTATGAAGAACGAGCGA
GCACACCGATACATCGGGAGGAATCAACCGTGTACAGCAACAACGCGGGCTTTTCTGAGCTTGAGGTCTACGGTGACTACCGTGTTCTTGTCATCTATGG
TGACGCGCTAGACGCCCTCGAGCAGACCAAAGCTCACGCGTTGGTAAACGCAATTTCGTTTCGCTATTTGGGTATTGCCAAGATCGTGGCTGCTGTCAGT
AGCGCTACAAACGCCAATCTCAAGCTGTTTACAAGATTGAGGAGATTTTTTTTCGCGTACAACGATCTCCAGTCGTTCGATGAGCTGTTGTGGCTGAATA
CTATGGGGTTGAAAGCTGAAGAGGTTGATGCTAATCAGGGTGTGTAGCCTACTGCTTCGAGTGCTAATTGTGTGACGCTGTGGGTTTCCAGGTATACATT
TCCCAGAATCCTGTCTGTGCCAAGACTCTTCTCAAGAGATTCATCGGTGCTCGAATCAGTGTGCGTTCGTTATGTGCTTCTTTGGTGTGGCACCTCCCTC
AGCTTATCTATTGATGTGTGTGTGTCCTCCGGTAGAATATATTGCGCCTCAACGGCGAAGAGATCAACTCAATCGACAGACATATGGGCAAGCAGCTCTT
CCCAAAGCCCAGTGTCCCCCGTACGCGAGCAGTAGACGCTCCAGAGCTTCACCCATTGCTGCCCTCAAAGGCTCGTGTGAAAGAGGGCAGGGACGCGAAA
GTGCCCCGATCATTGTCAGTTCTGCACAGTTCTGCCACACCCTCCGCAGTCACCGAGATATTCGACGCAGCATCCGACATCGAAATGAAGTCCACGGTAT
GTCATGTGCTTGTCGTCCTGTCCAGTCTCCGGTCACCTCACTGCTCTAACTGATGTACCGGTAGGCGCTAGACCAAGCGTGGAAGGACATGCTCTTGACA
ATCGTCAAGGTACGAGCTTTCCTCTCATCACTATG