Description :
From Genome Similarity Track
Location :
Scaffold_27:414011- 416089
Transcript NameFunction/comments
Physo_133711hypothetical protein

Sequence
2078 bases(100 bases per row)
CAGATGACCCAAGTCGACATCAGCACTGTCATGTACCCAGAGGACAACACGCTGAATGAGGACGCTGTCCGCGCCTACGCCCAGCAGTATGTCGGGTCGT
ACCTGAACACCATTTGGGACGAACCCCTGGGTGAAAAGTATGGCTGGAACGCAACCGAGTGGCGCGCTGTAGTGACTCGCATCCAGGAGATCTCAATGGA
GGAGAACGGAGGCCACCCGATCATCTACGGCCTCGACTCGGTTCACGGCGCCAACTACGTCGACGGAGCTGTCATTTCCCCCCAGCAGATCAACAGCGGA
GCAAGTTTCAACCCCGACCTCGTCTACGAAACGGGACGGATCACGGCGCGTGACACCCAAGCGGCTGGAGTCCCGTGGGTCTTTGGCCCCATTCTGGAGA
TCTCCCAGAACCCCCTCTGGTCTCGCACGTACGAGACCTTCGGCGAGGACCCATACCTGGCGGCCGTGATGGGAGACGCCATTGTCCGCGGTCTCCAGAG
CTACAACCAAACGGCTGCCTGCATGAAGCACTTCATCGGATACTCCAAAACCCCAACCGGTCACGACCGCGACAACGTCATCATGGCGGACTTCGACCTG
CTGAATTACTTCCTGCCGCCGTTCAAGGCTGCCATTGAGGCTGGCGCCATGTCGACGATGGAGAACTACATCTCGATCAACGGCGACCCCGTGATCGCGA
GCCCTCGCATTCTGAATGACCTGCTCCGCTCGGACCTTGGCTTCGATGGTCTCCTGGTTTCGGACTGGGCTGAGATCAACAACCTCAAGGACTGGCACCG
CGTCGTAAACAGCTACGAGGACGCCGTCCGCTTGTCACTCACGCACACCTCGCTCGACATCAGCATGGTACCGAACGATACAACCTTCATCAACTACACC
GAGAACATGCTGGAGGGCTACCCGCAATACGAGAGCCGCTTGCGTGAGTCAGCTAAGCGCATCATCAAGACGAAGCTGAAGCTGGGTCTGTACGACACGC
CAGTCCCTGGTGCGGAGTTTGAATTCCAAGTGGGTAACGACGAAGATAAGGCGGTGGCACTGGACCTGGCACGCGAGTCGATCGTGCTGCTAAAGAACAA
CGAGAGTGTATTGCCGCTGGCTAAGGAGGCGTCGGTGTTTCTCACTGGCCACTCGGCTGACAACGTTGGCCACCAGTGCGGTGGATGGAGCATTGCGTGG
CAAGGATACTCGGGCAACGAGATGTTCCCGAACGGTGTCTCGGTCCGCCAGGGCTTTGAGATCCTGGTCGGCAACGGCTCGTTCACGTTCTTCAATGGTC
TTTACGACAACGGGTCATACTCCGAAGCTGATCTCGCGAAGGCTGTGGAGCTGGCTGGCCAGCACGAGTACACCATCGCTGTCATCGGCGAGAAGCAGTA
CACTGAGAAGCCCGGAGACATTGACGATCTGGCACTGCCTGCAGGACAAATTGAGTACGTGGAGGCTCTCGCAGCCACGGGCACGAAGGTCATTGTTGTC
TTGTTCGAGGGTCGCCCTCGTCTCCTTGGCTCTCTTCCGGACACTGCTAGCGCCATTATTGACGGTTTGCTGCCGTGTGAGCTGGGCGGCCAAGCGATGG
CCGAGATCATCTATGGTGAGGTGAACCCGAGTGGAAGGCTCCCGATCACGTACCCGAAGGACCCAGCAAACATTGCCATCCCGTACTACCACCGCGTGAA
CACGCAGTGCGCCTACGACCACTGCTGGATGCAATGGGACTTCGGTGCCGGACTTAGCTACACCGAGTTCAACTACTCGGCAGTGACTTTGGATACGACC
AAGATCACCAGCGCAGACGCGACTGTCACTGCTAAGGTGACTGTAACGAACGTTGGCACTCGTGCTGGCAAGGAGACGGTCATGCTGTTCCTTACGCAGC
CGTACCGAACGATCTCGGTCCCCGAAGTTAAGATGCTGAAGAAGTTCAAGAAGATTGAGCTGCAGGCGGGCGAGTCCCAGGAGGTCTCGTTTGCACTGTC
TGTGGACGACTGGAGCGTGTACGACCCGCAGATCGGCAAGGGCTTCAAGAAGGTGACGGAGGACAGTACCTACGTTGT