Description :
From Genome Similarity Track
Location :
Scaffold_765:4140- 5365
Transcript NameFunction/comments
Phyta_totarag10603hypothetical protein

Sequence
1225 bases(100 bases per row)
TTGAACTCGTACAACAGCGTTCCACAATTCAGCTGACACACAGGAAGCCGCCCAGGGTCAGGATATCCCTTCCACTTCTCCAAGTACTCTCGGACTCTCC
GCGAAGTACGTGTTCGCTTCACCCATCGGACATCTCGGATCGCTTCCACCTCATATTCATCATGAGCTTCGTTGGGTCCATCAACGTCTTCAGGCAGTAA
CGCAGCATCAAAGTCATCTGCCTCAATTACTTCTACTTCAGTTGCAGGTCGGTCTGGGAAAGTGCTCGTGGCTTGAGTCGACGGACGTGGACTCACGGAC
ACAGCTTATACCCAGAACCTTCAATCCGCAGCTTGCAACGGAAGTCGTCTGAGGTTTCCATGATCCGGAACGGACCATTCCACAAGTGggcgaacttctt
ggtcagTCCGGGCCGAACTCGCGCTAAATACAGCCAGACGGCGTCTCCGACCTTAAATCCTTGTTTGAGCTTCTCAGACAGTTCTTCCCAGATCTTAATC
TGAGCTTCTGAGCGTTTCGACTTGGCCTCAGCTTGGAGATCCTTCGCCCAGGCTTGAACGTACTCGTACCGGCGCTGAACATTCTGGCGCCACTCATACG
CAGTTCGCTGATCCAGCCGAGTAGGAGGAGCACCTAGCATAGCTGATACCGTACTCTGAGGATTCCAACTGTGAACGAGGTAGAACGGGGTATCCAGACG
AGTAGCGTCGAAGGACGTGTTCAATGTccacatcaacttcttcacttggTCGTCTCAGTCACTTTGATCAGGCTCCGAGACATAtgctcgtacagctcgg
ACTACCGTCTGTACAGATCGTTCTTGTTGACCGTTGCCCTGAGGTCGATACGCCAGCGTAGCTCGCTGTTGACTTCCAAGCATATCCCGAAACTTGGTGA
ACACTTCGCTCATGAATCTCGGATCTCTGTCGTGGCGAAGCATGACACTTGCTCCAAACCTCTGGAAAACGCACTCCATGTATGCCTCCGCAACTTCCTG
agccgtcgtggtgctcataGGCTTGCAGATGACGAAACCAGAAAAACGAACACTGAAACAACAGCAGAAAAACGTTGCTTCGATCGGTCTTGGGTAAATG
CGTGACAAAATCCATGGAGTCCACCTCAAATGGACGTGTCGCTAGGATATTTCCAGGCGAGGGTCCGTGGTTCGGTGGCGCTCCTTTGGTCGTGACGCAA
TCCACACATTCCTTGACGTAACGTT