Description :
From Genome Similarity Track
Location :
Scaffold_2870:414- 1561
Transcript NameFunction/comments
Phypl_g15450putative polyprotein

Sequence
1147 bases(100 bases per row)
TTTGCCCTCGCGACTATACAGTCGCGTCTTCGTACGCTCGAGCACTATCGTCTGAGGCTCGAGTGTCCGCCACGGAACCCATGGAGATTGATGCcatcga
cgctgcaggtggccgtAGTCGGTCATTCAACCGCGGCAGTCGTGGCACTGGCTCCATGAACTGTTACCGCTGTGGCAAGCCGGGTCGTCGCCCGGCGGTC
TGCCGCGCGCCCGCGCCGGTGTTCGCGAACGCAGTCGTCCCCAGGAGCGACACTGTGTCCCCAGCAGCCCGCCAAAAAACGACCAGGACCAGTAGGCGCG
GGGCGCCCTACTGGCTGGAATGGAGGTCTGGGTCCCACNCGACCGGGACCAGTAGGCGCGGGGCGCCCTACTGGCTGGAATGGAGGTCTGGGTCCCCCGG
TGGCAACCCAACCTCCTAGCCCCACCGTGCAGTATGCACACTTCaatgccaccaccaccagcggcgACTCGAGGCTGATCATCGTCAGTCTTTACGTCGC
CAGCGCGCAGCGTCCTCTCCGCGCGCTCCTAGACTCTGGATCGTCGAATAACTTCTTCCGCACGTCCTGCTTGTCTCTGCTCCCACCCACGGTCACTGTA
CCCGAGGGTCCGggtgagctcgtcgtcaagctggccgacggGAAGCCACACCGCGTTCTGCGACGCGCCATCGCGTTGCCGTACACGTTCGATGGCTTCG
AGAGCAATGATGAGTTTCTGGTCTACGAGATGAACTACGCATTCGACTGCATCTTGGGGATACCGTGGCTGGCACGGTATCAGCCGCAGATCGACTGGTT
GGCTCGGTCGGTCAAGCGTCGAAGTGACTTCGACGTCAGCGCGGTGTTCACCCACCTACTGGTTGCACCGACGGACTGGCCACATGTCCGAGTCGTGGAC
CAAACCACCACGACACACGCCCTGCATANGTCGGACTGGCCGCATGTCCGAGTCGTGGACCAATCCACCACGACACACGCCCTGCAAAGAGTGAGCGACG
GCCCTCTCTGTACGGTATGTGCCGTGTCGCTGAATGAGAATGAGaacgaggcggtcgagcgaAGGCGACTCCCGCATGACaacgaggcggtcgagcgaAG
GCGAATCCCGCATAGCAATGAGGTGGTCGAGCGAAGGCGACTCCCGC