Description :
From Genome Similarity Track
Location :
scaffold_14:413994- 415427
Transcript NameFunction/comments
Plaha_PHALS_15290hypothetical protein
Plaha_PHALS_08225hypothetical protein

Sequence
1433 bases(100 bases per row)
AACTTACTGTTGCCATCTCATGTTTGGAATCCACTCAATCTGAATACTCGATCAAAGAACAACATTATCAACGCATGCGCCAGACAAACAAGAAATCAAT
ACTGGCAATTCAATTCTAAGGAATTGTGCATACGTATTCTGCATACTCCCCATCAGCAAGATCTTCATACAGTTCTTTTGTCATTCAAGGTGCTTTACTT
CATAGCTCCTTTTTTTGCAGCCTAGCTCTTCTGGATTTTGAAGATCGATTTTAGAATCATGATCTGAAGCGATTCCTTTTTTTATCTGTTGAGAGCAAAT
CAGTAAGGACTACCGTAGCCACACATGGATGATTCATTTCTCATTTTATCTTCGACAAGCAACGTCTGATAATGTACCGACTCGCTGCTCTTCTTGCTTC
CATGTCCCTGTCTGCAGGCGCGAACAGTTTTCTAACGAAAGCATCAATTTCGGTTAACGGCACGCAGGATCTCGCTCGTCACAAAGTTGTTGAAGCAGGG
GGTTATGAATGACGACATAATTTCGCTTACGGCCGAACGACTTCAGTATGGTCTTTTTCGGAGGTGGTGGGGTAAGAAAACTACTCCTAGTGAAGTGGAA
AAGTTGCTCATGggtgaagatgaagtgcttgACGATGTGCATATCGAGGCGTTCGTGCGATACTTTGTGCTATACAGTAAGGCTGCATTTGCTAGTTTGA
TAAAAGAACCCTCAAGCGCGTTGCTGTTGAATGATCGTGAGATTGCTATATTTCACAAGTTTTTGCACTACCCTGGGCTCAAGTCCCATTTGAACCTTGA
CGATATTTTCGAAAAGTATTGTCAAGGTGCAGCTTTTGACTCTAAAGTCCACCATTTTTACGAAGACATCATCGAATCTGTGAAACATCAGTGGATTGAC
GGTGTGCATCCAGCTAATGTTCAGCAATTTCTCGCAGAATTAACTGCAAACAAGATTGATTTTTTCATATGTGAAGTGCTGGGACGGTATACTCTGCTGT
ACAAAAAGATAGTCTCCGCTGTTATgaaaaatgaagaaattcCTGTCGAGCCAAAACCATTTGTACCTAAACGACCACGAATCAGGACTGGGTTGACATT
AGGCGAGCAAGAACAATTGGTACCTAAACATCCACGAATCAGTACTGAGTTGACATTAGGCAATGCACGCTCCAAGAGAAGGCGCCTGATTGAAGATAAA
CCAGCGGATTTCTCACCTTAAAGCATATCGTCTTCGGCCAATCTGAGAACTTCAATTGAATTGAGCGAAGAAGGCAATCAAGGTACTTCTGCTCTTCGCA
ATTCACCAGAAGATACGCATCAACATCTTAAGAACAAGGACGTAAGAAACGCTTATAACATCAGGCAACGTAGTGACTTCAATTAAGAAATAATTGGCAA
GAAAACACATAAACTCCATTTGTTTTAAGTGCT