Description :
From Genome Similarity Track
Location :
Scaffold_12:413978- 419683
Transcript NameFunction/comments
Physo_130687hypothetical protein
Physo_130688hypothetical protein

Sequence
5705 bases(100 bases per row)
TAAACTGCCCTATTTTTGGGTTGTTTTTGGAAGAGTTCCAATGGCACATTTATTGATACACGTACTGTACACATCAAGCACTTCGTTACTTTGTCGAGCT
GCCTACTGTACAGTTATTGCACTCTTCGCTTTATACAGAACTCCCCTGCTTACCCTCGCCTGCATAAAGTTTGGTACCTCGCACAGATAGTACAAATCAC
TGTTGTCAGCATAAATTCACCATATACTGATTTAACTGAAAACGGGAGGGAAAGTGTCGAGTGCGGGAAGCTTACACAATAGCTATGCGCCGCAATGTTG
TAATAAATCAGTATGTTTAGCCTCCTTTGCAATTCTCTTAGCCTTGCAAGATTTATTGGTCCCACCTTTTTGGCTGAGGCGGGGAGTTCTGTAGTTGATT
GAAGGACGCACATGTACTGTAAAGGTCCACTGCACTTGAAACTAACTTTCCTTTTGTGCCGACTTTACCTCTGGGCAATCATGGATATAGACAACCCTAA
ATCTGTAACTTACATCTGCCGAAAAACATTTGATTGACGATCAAACGGTTTTGCAGAAGACACGGGCGTGGAAAAGGGAACGCGACTGATTTCATCGTGC
ACCCTACACGTGTGTACAGTACATGTACCGCTCCCTACGATAGAGACGGAAGCTTTGACGGGGTCTGGATGGACGGGACCAGTTGGCGACACTTGCAGCC
TTCAGAAGCGCACAACTGTTTTCGCCTTCACGAAAGGAAGGAGGGGCACAATGAAGTTCACTCTACCGGAAAACGCCTTCCCGGACGTGCATCTGTCCAA
GGAGCACCAAGACGCGCTTATAGAAGAAGCCGAGAATCTCGTGCGCGAGACGCTCGCAGCCAACGAGGCATTCCTGGCTGACGGAGCCAAATTTCGGGAT
CCAAGATGGCGACTAGTGCGAGCAAAAGATGGGTTGAACGTGTACCACCGCCCACGATCGCGGCAAAGAAGCTCTCGGAGTCTACGAATGCCTCGGAAGA
AGGCGTTCTCACCGGTCCTGCTAAGCCAATCTCAAGCTACAGACCCGTGGGGGGTCAGCCAGCATGACCACGACGAGGCCAGCACTGACGACGAAGCATC
AGCATCTTCTTCATCTACTAAAGATATGGTGAGGCGTCCAGCAGGTTTCGAAATGATCCTTCACGGAACAGTGGACGGAATTCTGGACGACGCAATGTAT
GGGACTTTCGCCGCCACGGACCAGGCCTGGATGTGGCGGAGCTCGCATATCAACGACCGCCTCGACGACGCGCGAGTGCTGGCGACTATTAGAGGCCCCA
CAAAGGAGGACCCGTTCCGGTTCCTGGGTATCAAGTGGTTCGTCAAAGAGCGCCCTGCTGTACTGACAGGTCTGGTGCAACAGCGTGACTACCTTATCGT
GGAGGCCACGGGGCTCATGCGGGACTCGAAAGGAGAAAAGGTCGGCTATTACTTGATGCACTCCATCTCTCTGCCTCGGATCTTCCCGGAACTCACGGAT
TTGGGTCTTCTTCGAGGAGATCTGAGCCTCTGCTTCATTGACCGCCAGCTTGGGCACCACAAAGTCGAGAAATACTGCCGGAACTTCAGCGATCCCCGGG
GGAAAATCCCTGATCGAGTGGCTGTTGCGATCACCGCGGACGCGCTCATCTGCGCTGCGAGTATCATCGACTACGCGTACATCAAGAAGCTCACGTGGCT
CATGAAGGAGAAAGGGGAGGAGATTGCGGCGCGTCATCGTCGACCAAGTGGCGAGGCGCGACCCAAATGCTGTGAAAACTGCAGCAAAAGCTTCACCAAG
TTCTCCCTGCCTGGGGCTCGATCGGGTGTCGACTGCCAGATCTGTCGACGAGTGGTATGCGGACGCTGCAACATGATCAAGAAGATGACGGTGGACATAT
CGGAGACGGGCGCTGTGAAGCAGTGTGCGCTGCGCTTCTGTCTGGAATGCATTCGGGAGGCCAAGGAGAAGTCGGTCTGGGAGATGGCCCTGACTGGCGT
CGAGACTGCATCAGAAACGTCGTCTGCATCTGCGTCTGGCTCATCGCGGTCGGGACGCTACCGATAAGTAAGACAGAGCTACAGTGGCAAGTAAAGGAGT
AGCATCTAATGGAAAATTTATGAAAGCACACTATCGTTTGAAATGCATGTAGTTGCTCGGATCAACTAAGCTAAAGCCTACTTAAAAGGATCAGTCAACA
CAATAATATATATATTTCTATCCACCCATTTTTTTGCTTTTGTTCATTCACAAACACTGACTAACGTGCCGAGCAACTATCACTTCGTTGCTAGCGTTGG
TCCACAGTACCGGCACCCCCATAGCTTCCTTTGCAAGTCTGATCAGTCTAATCTGGGACTCGATGAACATCTTGACGAGGTTTCGACACCACTCAGCGCC
AATTCCCAGACCGACTTTTCCTTCGCTTCGATGAGGCAGCCGACACAAAACCGGAGAGCACACTGCTTCACCGACCCAGTGTCAGACACGTCCACGGTCA
TCTTCTTGACCAGGCTGCACTTCCCACACACCACGCGGCGGCAAATGTGGCACGGGGCCCCCGATCCGACACCAGTCAGTGCAAATCTGGTGAAACTCTT
GCAGCAGTTGCTGCAGTGAGAAGGCCGAGAGGCTCGAGTCCCGTGTTGCTGCGTGACCCCCTTCTCCTTCATGAGCCACGTGAGCTTCTTGACGTACGCG
TAGTCGACGACTCCGGCCGCGCAGATCAGCGCGTCGGACGCAATAGCTACAGACACTCGGTCCAACATCGCACCACATGGGTCGCTAAAACCCCGACAGT
ACAGCTCGACTTTGCCCGGGCCGCTTTGGCGATCAATGAAGCATAAGCTCACGTTACCACGCACGATGCCCATGTTCGAGAGTTCAGGAACTTCCGACAG
CGAGACCGAGTGCATGAGGTAGTAGCCAACTACTTCGACCTTCGAGTCGCGCGTGAGCCCCGTGGCCTCCATGGTGAGGAAATCCCTCTGCTGGACGATC
CCCGACAGCACCGACGGGTGCTCCTTAGCGAACCACTTGATCCCGAGGAACCGGAACGGATCGCTCTGAGTCGGTCCTCTGACAGTCGCAAGGATGCGGG
CGTCGTCGAGGCGGTCATTGAGGTGCGAGCTGCGCCACATCCAGGCTTGGTTCGAGGCCGCGAAGGTTCCGAACATGCAGTCGGCCAGACTTCCGTCCAC
CGTCCCATGCAAAACCATCAAAGACACCCCCGGACGCCTCAACTTGTCCTGAACACTGCTCCCAGGTGGCGAGGCCTCCCCGTCAGTGTCCTTCCACCGG
GTGTCGCTACCCGAATGACCTCGACTTTTGAAGGACCAAGACGAACTCTGGCTTTGGGAGGACGACGACCCCGGAAGTTTACCCAACGCCTTGAGCCCGC
CAGACCCAGACTTCGGTGGTCGCTGGCGATACACACTCAGTCCCTCCTTCGCGCGCACGAGTTTCCACCTCGGATCTTGAAAAGTTGCTCCTCCGGCCAG
GAATTCTTCATTCGCAGCAATAGTCTCCCGCACGACGGTCTCCGCTTCCTCGATCAAGGCAGCTTGCGCCTCCTTGGACAAATTCACAGGCGGGAACGTG
TCTTCAGGCAGCGTGAACTTCATAACCTTCCTCGGGGCTGGCGCGACGCTGGATTGACTTGAGCGTCAAATTTGTTGTGCTTGTTCCACGTCGAGTATCT
GACAACCATCCGTGCCCCGTTTCGTCAAAGCATCCCGTTTATCCTAGGTGAAGAGCTTCACGCTGCTTGCGCTTTGTGTCTCTCTGCATAGCCTGCATTT
CTGTGCTGTTTCTTAGCCAAAATACTTGAAGCCATGCTTGCCATTCCCACGTCTATCCAAGGGACCCAAGCGGCACTCGAGATTTCGTTCGGCAAAACCA
CTTGATGCCACTAGCAAGTGGTTTAACGGAATCCTGACTCATAATACTTAGAGCGTGTTCGCTACGCAGCTGGAGATGGATATCTGCAGGGAGTTGGTGC
ATCTCCATCTCCACGCATCTAGGTAAAATTACCCAATCACAGTGCGACTCGCTCTCCTTCTCCTTACTTTGCTGTTCTTCGTCGGCCGAGAACACTGTGC
CCGAGACACCGGACGCGTGGCAAGATGGACCAAGCTGCCGATGACGCTCCGAGAGCTGCGCCTCCGTTCCCGTCAGCCAGTGGCGACCTCGTGCTGGCTG
CTGCCAGTTTGGACATACCTGTCTCTGATGTTGCTCTTGCCCAGACTGTGTATGCGACACCGGCCACTACTCAAACGGAGCTGGATGCCCGCACTTCCTC
GCTGGCGCTGCCGCATTCAGAGACACCCAGCCAGCTTTTTGCGCTCGGAGTTGTAGCTGCGTCAGCCCGCAACCAACACTCACATCGCCGCGTTGGGAAT
CAGAAGAACAAGGCCAATACTGGTGAAACGTCTATCGCTACGAAGCAACCCTCCTTTGCGTGGACGACTGCAGCAGCTGATGCCCTGCTGCGGGTTGTTT
TGACACGGCTGCAACTTTCTTCTCAAAGCTATGCTGCCGTACTTTGGCAGCAGCAAACAGAACACCTTGATCTCGTAGTAAACCAGCAATACGTAGAAAA
GTTGGCTTGGTGCAGCGAAGATTGTCTTCAAACCAACTTGCATACGCGGCTGACTGTAGCATGGGCAGCTGCGGCTGAACTGCCTCAATCTCCAGCTACT
TTCTCCTTCTCCAGCTCCCAGAGTTGGAGAAGGAGACGGGGTAATTCTCCAGTTGTCACGTTGTGAACTAAACTTTTTTGACCAATCAAAAGACAAGAAA
TAGAGTTGATGAGAGGTCATCTCCATCTCCAGCTACCTAGCGAACACGCTCTTAGGTTGACACGGGTTTCTGTGTTGGCCCCCTCGTAAAGAAACGAGCT
CTCGGAAATGGCCAAGCTCAGGTCACGAGCATTTTGTATCAATAACCCTACGATCACTTGAAGGTTTGCGAATGCACAGTGTGTAACACGGAGTGTGCTG
TTCTGATTCATGTTGTCGATCGTCAGAAGCGTCTTGCTTTTTGGCTGCATGCATTTACAGTATACCGTAACTTACAGTACTGGATCATGGATGCATCATA
ATATATTGTATGAAACCTTTGACTGCGAGACTCTGTGTGTGCTTCTTTCTAACAGTACTTGTAGCCTTCTCCATTTCACTTTTCAGAAACACTGCATGTA
CTGTACAGTCGATTTTTGCTGTAAACTTAAATTGTTATCAAGTAGCTAGGAAAAATATGCACGCCATTAAATTAACTGGATAGATGTCCAAGCGTTGCAC
CACAGCGAGACACAGGGAATATAGTGCAATTCAAGTACCCCCCCCCCGCCTCACGGATTTCTAGAAGTTTTTTAAAACTTTAAGCTACGAGTAACTTCGA
CGAAACCTTTTGCGACCACCGAGAAGCAACTGAGCCCACGGGATAAATAATTGCTGTGAAGCTCGCTCTCGCATGGTGCCCATCGATCGTACGCGGCATC
AATCCATTTCTCATCGATCTCCGTAAGCTTCACACAGTACCCACCATGTCTGACCCACTTGACGTCACGGTTTTGCTCAATAGAGCGATAGCGATCGTTC
ACGCAACGACAATGCGGAATCGGATGGAGCGCTTTCCGTCGGCTTCAATCGCCTGGACGCGTTGGGCAAGCTGGACGTATCGCAGCCAAACGCACACCCC
GTGTG