Description :
From Genome Similarity Track
Location :
scaffold_1282:4139- 5144
Sequence
1005 bases(100 bases per row)
GCATGTTATTGGTAGAAACGTATGGATTTCTACCAATCAGTGCGTGACACAAGGGTAGGGGTTCTGCCAACCACACGTTGGCAGACATTTTAGAAATAGA
TAAACAGATTTAGGAGGTTCGATAATTGGCTTTTGCCATATTCAATAACAGTTCTCATTTTACGGTATTTCTGCAGTTTAATTGCTTATATTTGGTTTAT
TTATACTTACTCAAGTAAGTATAATTAATCTAAGTTAAACTAATTGCACGCTTCCTCATACACGTAAGCGCACGTGTACGCCACCTAGTGGGTCTAAGTA
GACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCCACGACCGACTGCAGTTCGTTCGTATGGAATCATACGAACGTGGGGTTGAGAACCTTCCCATGG
ATGAGGGGTCCGCGGGGACCCCGAACATGTCCGTGACGCGCACGGACTGTGCCCACCTGTCGGACCCAGAGTGGGAGGTTCTCCAACGACTCTCGCGAGT
CATTGGAGAGGCGGCGGTAGCGACGATGCTTCGTACGCTATCGCCGACAGAGCAACACAGGGTTGCTCTGGGGTACATTGTTAAGGAGCACGCGATGTTG
CTGCCTCGATGACTTCCCCGAAGCCGCGCGTGGAGTCGTTGAAGCTCCACGTGAGTACCTACACGGGGAAGGAGGATGAGACCCTCCTTCGTTGGCTTGT
CGAACTCGACGCTGCCGTTACGGCTCGACGCATCGTCGACCCGCTGTCGAAAGTTGCGTTCGCCATGTCGTGTCTTGGCGGACGAGCAAAGAGTTGGGCC
TATGGGTGCCGACTCTCGGATCCTACATGCTTCAGCACGTACGAGCTGTTTAAGGAGGAGCTCAAGCTTGCGTTTGAGCCCCCGAAGAACGAGTTCAGAT
CGAGGGCGGAGTTCCTCGATCTGGAGCAGGGCAAGGATGACGTGCATACCTATGCCCAGCGTGCTCGATACTTGGTATCGAACATAGTGGCCAACCCGGT
CGACG