Description :
From Genome Similarity Track
Location :
scaffold_66:41384- 42901
Sequence
1517 bases(100 bases per row)
CAGGCTACACCGATCATCACGTTCGAATCATTTTAACAGTTCGGAAAACTCGGTTGATTATGGCAGTCAGTTCAGTGTGGAGAATCGCGTGATGAATTCA
ACCGCACGCCTCGCGCCGACAGGCACATTGGATTTGTGGATTAGTGTGACTGAGTGTTAGATAAATGCACGATTCCCGCAACTTACCGTTCTGATATATC
CGATGCAAGTCAAAACTGGTTTGGGCTTTTTCGACAATAATCCTGGTATCCGTTGGGCATATCGGATACGCAAACTCATCACAACCCTGGACTCAATCTG
AAGCGCGGGAGAGTAGAAAACGAGTCACGCGTTGTTCTTCATGCATTCACATCTTCGTTGGTAATTGTACCTGACAAAGGTGCAACCCACGTGCATCAAA
CACAATACCAACTTGCTTGCTTTACTACTGGTACCCAACATCAGATAGTGCCAACCGAATTCGTGTATTTATTAACTCGACAAAATCAGCATAATCCAGA
CGGACGTGCGCTGTTTTCATACCTGACTCACATTGCCGTATAGTCCGTCTCGAAAGCGCCACCTGTGTCGCTGAGATCTGCAAACAAGTTCTCTTCCCGC
TGACGGGCGAGCGCTTTTTGCCTGAAGAGCACTGCGGCAACAATGACAGCCACGAAGATAACACACCCAATGACAATACCTGCGATGGCTCCTGCGCTTA
AGGCACTACCAGCCGAGCCAGTGCCACTATCACCACTAGTTCCAGCTCCAGTATTTGCATCTATGACCGTAGTCGTCCCTGCATTTGCATCTGAAGTGTA
ACCAGGAGACACATTCGTCGACGTTGTAGTTGTCGTCGTGTTTCCAGTCGAAGCTGTTCCACTGTTTCCCGTTGTCGTTCCAGTTATTGAAGAACTAGAC
GTCCCAGATTGGTCACCGTACGGCTGTGTAGGAGCAGGAGTCGAGCTGACCACGCAGCCATACACACCAGTGTCGAGAAGCGCGCAGTACGTGCCACCAG
GACAGTCGCCATTGCTCACCTGGGCCCTGCACACGTTGTCCGAGTCGATGCAGCCGTCGTGGTCCCAACCGACAACACCGATCGAGTGTTCATTGCTAGA
ACAGCGGTCGCCGTCCTTGCATCCGTACACACCCGTCTCGAGCCAAGCACAGTGAGCACCACTCGGACAATCGCCGTAGATGTTGGCAACGCACACGTGA
CCCGAGTTGACGCATCCGTCGTGGTCCCATCCCGCCACGCCGATACTCTGTTGGCCATTGGGGCATGAATGTCCAGGTGGCTGTTCACCGTACGGCTGTG
TAGGAGCAGGAGTCGAGCTGGCCACGCAGCCATACACACCAGTGTCGAGAAGCGCGCAGTACGTGCCACCAGGACAGTCGCCATTGCTCACCTGGGCCCT
GCACACGTTGTCCGAGTCGATGCAGCCGTCGTGGTCCCAACCGACAACACCGATCGAGTGTTCATTGCTAGAACAGCGGTCGCCGTCCTTGCATCCGTAC
ACACCCGTCTCGAGCCA