Description :
From Genome Similarity Track
Location :
Scaffold_277:4138- 6366
Sequence
2228 bases(100 bases per row)
TATGTACGAAAGCTTTGCGCATAACATACTCAAATAACAGCTCCTAACTCGTACTGGTCATAGAATTACGAGTAAAAATATGGGTGGCCGTATATCTATG
GCCCGGACTGTAGCTGGCTCTCACTTATCCCTCAAAATAAAGGTGAGGCTAACGCACCACATATCTTACTTGTAAAAGACCAATCTGGTGACTTTAGGCG
CCTGCGGAGATTTTCTTTAGAAATGCTTTCCGGAAACACCATCTCTCGTACAGTTCTTTCTCCCTATGTTGTTAAGAGCATAAGTGGCCCCTCCCGGTTA
TAGGTATCCGATTTACACGTAATGCATCTTGGGCGTGGGCGCAATGACTAGTTGCTGGATCCAAGGCAAACAATGCCTGCTTTCCAGGAAATAGAGCCTC
GAATATCAAAATTGCGTGTTCCCTGACTTGATTGAGGCGGTCCTTAGCGTGCCACCGGCCATCATTTTAAATACTAGGCCTCATGATCACGCTCCTTCGA
TTGGTATGTCCCGATGGCATGCGCGTTACTCTTCACCGAGTGCTAGGCGCTCTTGTTTTACTGCACAAGAAGTCGCTGACATATATAGAACGCACTTTTC
CATTGTGGCAAATTCGTTACTCCCTCTTCGGCATCCACAGATGCTTGAGTCCATCATGTGCAGCAAACTTGCTCTCGTCATGATTCACCTGGATCAATGG
CCGAATGCATTCTTCAAGTCAATTGACAGAGACACATTGCTTATCACCGTTGTCATCGGTGGCTTCGATGACCGGCATGGGTTCTTCAAACGCCACGTTC
GATCCATAAACTTCTTTCGTAGTCGACAACACTCTCGCGCTAGTGACATTACACGTAGTCATTTCTCGACTTCTCGATAGGTAATGTCGAGATAATGCAG
CCATCACATAGCGAATATCTGAAAAATGGCCGGCAAAGTGGCATATCCAAGATGAGGAAGTGTTTCCTCGTGATCAGTTGGGACAGGAATATCCACCTTG
AATTTGCTAATTCGCACGTATTGCTGAAGAGGCAAAAGGCAGTGCTCGTCATGTAAATAGTTGGACCGCTGCACATGCCTCGGAACGTCGGGAGCGTGTT
GTCCGTCAAGAACGTCAAAGCCCAAATGCGAACCGAGCGGGCAAGCTAGACGTATTTTCTAGTACTTTTAGCGGAAAGGTAGCTTGATGTTGTGCGCGGT
CTGACTGCCCCCATGATCCGCAGATAGTAAAGGATGGCTTCAAGTCGATCACACGTAGCTTGCTGCAGTCAACCCACCTTCGTTCCTAAGTTTTTAGCTT
TATGATTGCCACGTCAAGCTTTACTTACGTCCAGTCTTAGTTCTCCATGTCACTACTGTCGTCTCCAGTTGCGTCTCCTGTCACTTTGTGCCTTTATCAT
CATTGGTTTCGCCATAACGGTCTAGCCTTACTGTCGACTTCCGATAAGCCGCGAAACTTGAGCACCTAGCAGCTGCACATATCCAATCCGCGTTCTTCCG
TCCAGTTACGAACTATGTTCCTTAAATAGCTTGCCGTTCTGTTTGTTGTTGTGGTAGAAAGAGTAGACTGATAAACTTTCTGAAGGATCTTACCTACCCC
TTCGGTCTCCAATTTTCACCATACTCCATCTCACTGTCAGTCTCTGAAATCTCTCTACCGCTAGGTCTTTTGCTAAGGCGTTAATCATAAAACTTTTGCC
CTCGTCATCTCCAAAGAAAAGACCGGCGGCCACACAAGCGCTACTGCCTTCGTCAAGAGTATCGGACACGCAAATGCTTTCGTAACTCGTGTATTCGGTT
TCTTCCGCTTGCATTTAACGAGCGTGAAGAGAGCGTCTTAGTCCTCTTTGATTTTTTTGTGTGTATCATGGCATGATAGATTGAAAATGTTGGCGACCCA
CTTCGTGTTACTGGAGCGTGGAAGATGAGAAATTTATGTGGGCCGCTGGTGGACCGAGCGTTCGCGACAGGGCCTAGGTTACTTAAAATCAAGTAAAATA
AGATGCAAAAATACTAAGCTTCAATTTACTAACAATTGTTTTTCCCAAATTTTCCGCTCGAAAACATGGTCGATGGCCATTAGCGGCCTGCACTGTATTA
AGATAGGGAAGCAAGTTCTGGCTCGTTCTTTGATATAAGTAATCCAGTTCGAAGAAATGAATCAAGTTGCAAAACACTATACAACAGCAGCAGCCACTGT
AGTATAAGTATGATGATGTTAATGTCTG