Description :
From Genome Similarity Track
Location :
Scaffold_208:41378- 43669
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_208-fgenesh-gene-0.12Cryptochrome

Sequence
2291 bases(100 bases per row)
CGACGCCGAAGCAGTAGAAGAACTCGCGCCACATGAGCTGGCCGTCGAGAGTCACTGGTGGAGGGCCCTGaCGACCGGGGAACTTGAGCTGGATAAACAT
GAtGCGGTAGAAGAACTCGCGCGGGCTCAGACAGCCGAATGCCACGTGGGCACTGAGTGTCGTCGTCGACTGTTTGTCGGTGCAGGCTGGTGATGTCCGA
GGCTTCTCGAAGAgaCCGAcGCGCTCTTCACTGGCGCAGTACTCATTAAGAAGCTCAAGAGCGACTGTCTCACCTCCGTAGAGGAACGAGTGGTGCTCTG
GGGTCTCCAGATCGAACTCTGCGAGAGCAGGGACGCCAAACAGCTCAGCTTCTGCCGATTTCCcTcGACCAGCAAGCGCTTTGGCGGtGACTCTAATCGC
CACCGCGTGTCTGGAgCAGTACGACGCTAGCACGTCGTACAATACCTCcTGCTTGTCTtCcAGTGGTGGCAGCTTCGATGGGGTCGGTAGTGGCATTGGA
GGCTGTGGTAGCTCTTGCGTGATCTTGAGGAACGCGAAAAATCCGTGGgCACCTGGCcGCCATTCTTCTTCAGGATGGCTTTTGGATCGAACAGCGTGCG
TCCATAAACTGTGTGCACGTTGACAGCGAGCTCCTCTGCTACGCGGTTCACgaCGTCGTCTCGTTTGGTTGCATACGGCATAACgAaCTCTTCATAGAAG
AGATCCGTGATTCCCCATGCTGGCAGGATCGTCCTCATCACATCCACTGCCTCGCCATTCaCAACAACTAGGTCCGATCCTTTCGACTGAAGCGACTTCC
GCAGATCGTGCAGgCACTCGAGCACAAACTGAAACCGCACAGGGCCGCACTTCTTCTTCACAGGCTTGTGGATGATGTAGATGGGGATGACGCTCATGTC
CTCGTCAGCTGACGTCTGCAGTGCCGCATTGAGTGCCAAATTGTCGTGAAGACGAAgaTCGTGGCGGAaCCAGACGAGCGCCCTGCGCTTCCGCTTAaGC
TCcACGGGAGGCACGACGACAGTCAGTGGCAGTGGCGTCTGGAagTCGATCGAGACGGTGGCTGTGACGGACGCATGACTACACTCGGCCGACGCAGCGT
TCACGTCGCGCCAGCTCTCGTCGTCGTCGTCACCGAGCAGGTCTGCGTGCCACAGCTCGTCCATACTGGtGTCATGgTGGTTGCTCGCGTCCGTCGGtGC
CGTTGCGAATCCCAGTGGCGAGACGGCGGTCTCGtCGCTCGCTCCTGGGAGCGTCcGTCGACGGCCGCCTTCGGTAGTCTGTTCCGTCGCAAGCACGTGc
GCTTCGTCGATGGTCATCTCCGCGACAGGGAGCGTCGAGACCTGGCGATAGTCGCTCGCCTGACGGTTCATCGAGAGCATCGTGGCCTTGGTGGATCGTG
GAATAGAGGCGTCCgCCATGAGTGAAATGGCGCCAAACTCCGCGTCTCCGCCGGTCCAGAGATCGGAAAACCGAGGCATCGCGTGCAGCATGCGTCTCGC
CGCCTCCGCCTCGTGCCCCGGCCCTGGCCCGTCCGCTCAGCGTCTCGTACTTGGCGAATTCCTTCCgCATCGTCCTCGCCATGGCGTCGGAATTCCCTCG
TGTTCATGGCGTCGTCGTGCGCTGACCAGCTGGTCGCCGCTGAGGTGTTGATCCCTGGTCGTCGGACCTGGTGATTGGTCAGAATCCACCTGGTCTTTTG
ATTGGTTGGAATGAAGAGCGACGAGTCTTCTGATTGGATAAAaGACCTCGTGATGGCCCACCGCCCCCTGGGCCAtGTGACCAGCCACCTCCACTTCAAC
ATCATGTCCTGGCTTCGTGGCTGTTCGTAGTGtcGCGAGGGACcCGAACTgCcTCCGCCATCTCAGAAGAGCGTCCGAGATGCTCACTTCAGACTACTTA
TGCTGTTTGTACTGGATGTTGTCTCCAcTTTCGGTGGCTATTTTCCTATAcGTCTTCTCAAAGATGGCAcACAAGTCTGCGTCGACGTCTTGATCTGGAt
GATGGCAGATGCTGTtGTCTGAGATCCGCGAGGGCCATGAGTCCGGCTTTGGTTGCTAGAACTCGCTACTTATCGATGCCAACTATTGTCTTGTCTTCAA
TTACGTCAGTCGTCTTGACAGGGTTTGTTCTCTTCATCGTCTTCAGTCTCGTAAACACACCACcAAATACCTTCTTtGTCGCTCGAGAGCGGTGGAGGCT
GCCTGCTGGTGAAGTTGATGTAAATGGCGTCGTCACGATCTTGCTCATGCTCCTACGAAACGCTATAcGCAAGCAGCACcCACTCCGACTC