Description :
From Genome Similarity Track
Location :
Scaffold_106:41370- 47801
Transcript NameFunction/comments
g9467.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
6431 bases(100 bases per row)
CAAACCGGATCGTCGCAATATGCCTCAGCCACATCTGAAGCAGGATCGGACAGCTCGATCGAGCTGCAGCGGATGACGCTTGGACCGGCTGGAGCAACCA
TGCTACAATCACGGAAAGAGCAATCGGAAGCCAAGCCGACGGAGATCGCGTCGAGCGATCCAGTCCAAGCGCCGCCCGAACGCATGCAATCGTTTTTTAA
TGCAGCGATGGAGCGTTTCCTGAAGGAACAGCAAGCGACCGTGACGCCGCCAGCTGCCGTTTGGAACAGTCCAACCGGAGCTCAAGACGTGGACATGGAG
TCCGTGGGATCAAACCGCCTAGATCATTCGCATCCAAGTGAGTACGATCCGGACGACTTGAACGTCGGAGTTGCTTACCCGTGCCGCAGTTGCTTCTGCT
GGAGCCACTGGCGGCGGAACACTCTCTTCCACCCGTATCAGGGTTTCTGCGATCTCGGAACTGAAGGAATTCTCCGGGAAGGATAATGACGAAGATCGCG
CTAGAAGCTGTTTCAGCAAACTGAAGTCTGCATTCACTCGTGATCAAGCTCCAGACGGCGAGAAGTGTCTGGTGTTTGGTGACTTGCTCACTGGACCCGC
GCGTAACTGGTACCGACAGCTGAGTCGAACGACGCGTGGCAACTGGAAGGAGTTATCCAAGAACTTCCAAACTCAATGGTGTATCTGTCGCGAGACAATA
CTACCATGCGCGGAAGAGATCGGATAAATCACCGTTGGAATACCTGCACCGTTTGAACGTCGCTGGACTGCGAGCTCAGCTCTCAATTAAGGATGGATCG
ATCGAGGTTCGCCGTGAGCATGTCGACCACTTTATCGAAACGCTCGACGACCGCGATCTGGCCAGCCAATTGGCACTGTTGAGGATCCCGGACGCAGACA
CTCTTGAAGAAACACTGCGATCCCGACAACGCGCGAAGGCGAGACAAGGAAAAACGGTGTATGGATCCATCAAACCCAAGCAGAAGACGCCAACTGGGAT
CACCCCATCCGCCAACGCTCGCGCGGTTCGTACAGTCCGTACAATGGCCAACTCGAGTGAGTCCGAACCGGAAACCAGCGGATCGGAAGGAGAAGGAGAT
CTGCGCAAGGTGTACTTCGCGGCAATGCCTGACCAGCCGACTCGATCGCGATCGGATCAAGATCAACGTCGTCTTAGTCGAGACTCCAACGACCGTCGCC
TCGATCGTCCCACCGGACTACCCGAAGGAGACATCCCGCGGAAGCCATGTTCCCACTGTGGATCGTCGAAGCACACCGATCTTGGTTGCTGGAAGCGTCT
GACGTGCGAGAAGTGCGGCAAGAAGGGTCACCCTACTGACCGCTGCCTCTTCGTCTGCAAGGCCTGCGGCGAGATCCACGGAGCTGGAGAGTGCCCGATG
GAAGAGTTTTACAACTTGATCCGTCAATGGTATAACCCGAACAAGCACGGTGGAATGCTCCCGCAAGCGGCCGAAAAGATGTTAAACTAGAACGCTCGCC
GGGTTTGAATCCGTTACGAGACGAGCGTTCTCAGTTCTGCATCTATGCATATGTCGAAAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTCGGCCGACC
GACAATACATGTGATCTTCATGACAAACGTACCATGGCGATCTCCAGCCTCCATCAAGTCGACGAATACTCGCGGTCGGAGGTGACGATGGCTTTGGATC
TCCTGCACGGAGAGTCACGAGGATATTGGAAGTACCATGTGCCGGACAAGAAGTTTCGGCAGGCGAAAGCCGTGGGGAAGATCAACAACGAAAGAGCCAC
ATTGCTGCTTGACAGTGGCGTCGAGGTATCCATTCTGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACGTGGACAACAGTCAAGAGTTGGAATGTGAAG
GAGTTGGTAAGAGTCCCTACATGGCGGATGGACGTACCAGAATCAAGATCACGCTCGCGGGATCGCTGGTGTACTACTTCGACGTTTGGGTTGGTCCACC
TACCGGTGGCCAAGACCTAATCCTGGGGATGGATTTCATGGTGCCGGCTGGCATCCGCCTCGATCTGGCTGACGGTTCGATAAATCTTCCGGACGAGGTG
CGGATTCAGATAGCCGGTCGACGTCAGCTCTACAGGGAGAAGGTGTCGCAAGTCAGGCTCGGCGAGCACTGTCAGTTAGAAGTCGGAGCGTCGGTCGAAG
TCCGGAAGGGTTTCATTCCGTCGAGCCAGGGTTACCCGAGGAGAACGATGGGTGCCGAGTTTGATTGCTGGACTAGGGAAGACACGCAACCTGAAAATCA
CGAACATCAGCAATCGGAAGTTAGTGTTGCAAGATGATGCCCACATAGGCATGTGGCTCGAAGGAGGACGCGTACCTCACGCTCCTGGTTTCGTACTGAT
CGGGTCACGCCGGTATGCTGAGTGGCAAAACCTAGCGTTTCAAGCCACCACAGATCAGCAGCCCGAGGAAGAACCAGACACGAGGCCCGTTGGACCGATG
GTGGACCGACCCCAGTACGTCACACCGACGAAGATCTGGAGTCGAGACGCCGGGGCGCCGAAGGTAGCTGTCGCTCAAATCACCGAGTCCCGCCCTGTTG
AGACAAAATCGAGGACAAATACCCCCGGGATCAATGAGGCGCACGAAGAGGGTAATCCGATTGCGACGGAGATGTCGTCAGACAGAATGGAAAAGCGAAG
CGACGGGATGCCTATCGGAAGAGCGCCCATGATCGAGCCGAAGACGCCGCCGATCACCGAGTCGGAGATACCAGATGACGACGAAGTCTGTTACCATGAA
GGAGGCGACTTGTTCGCGGAAGACGTGGAAAAGCAGATGGCTGTCTTGCCTGAGGTAGCAACCACTACCGACGAAGTCATGATCGAAGACATTCAGGTGG
GAGACCCTGATTTCAACACCCCTGAGGAGGTCGATCGTCTACGACAAATCATCTGGCGCCGGCGTCACCTACTGATCGGAAAGGGAAACGCGTTACCCCC
GGCGGCTGTAGGCGCGGTGTGCGACATCGACGTTGGGGGAGCAACTCCTGTCGCCCAACGCGTTCGCCGGGTCGCCCCACAGTTTCGCGAGAAGCTGTCG
GACCTGATCAAGAGTTTGCTGTCTGCGGAGATGATCGTTCCGTCAACCTCGCCGTGGGCATCACCGATCGTGATCATCATCAAGAAGAACGGTGTTGACA
TCCGACTCTGTATCGATTACAGGCTGGTGAACGGATTGACACGACTGATGGTATATCCCATGCCGATGATCAACGATCTCTTGGAAGATTTGGACAAGGT
GCTCTGGTACTGCTCCCTCGATATGGCCAGTGGTTTCTGGGTGGTGTCAATGACTGAGCGAGCTCGGAAGATCTCTGCCTTTGTCACGCCATTCGGACTT
TTCGAGTGGACGCGCATGCCTTTTGGGCTGAAGAACGCCCCACAGATTTATCAGAGACTGATCGACAACGCGCTGTATGGACATCTCCGAATCCGCGCCG
GTCACGACCCGTCGAAGCCGATCGACGTGTTCGAGGCAGGGGAACCAGAGCCGGAACTGAAGCCGTCCGTGCTGGGAAGATGGTCGTACATCGACGACAT
TCTCGTTACGGCGACCACTAGGGATACTTTATGTGAAAAGGTTGAGAGGTTGTTGGACGCTTGCGAACGGTGGAATCTGTCGATCAGCGTTGTCAAGAGC
TTCTGGGGCCAGCGCAAGGTGGGTTACTTGGGCCATCAGGTGTCTGCTGATGGTTTGGAAGCTCACCCGAAGGACTTTGAGGCGCTGAGTAATCTCCCCT
TCCCGCTGACGCTGCGATCGATGCAGGCTTTCCTCGGAAGTTTGAACTACTACAGTCGCTTCATTGAAGACTTCGTGATATATGCCGCCGTCTTGTACGA
GCTGCGCGAAGCGGACTTTCATGAGATCAGCCGTCTAGAGAGGGTCAACCCTGACCAACAAATGACTGGGGGCGACGAACCACAGATTCCGGACGCTGAT
CGCTGGACCCGAGCGAAGATTGCCTTCACAATGTTGAAGGCCAAAATCGTGTCCACACCGATCCTGAAGCATTTCGATCCCGATCGCACTCCAGTGATCG
TGGTCTACGCGAGTCAGTGGGCGATATCTGCGGCACTTGTGCAAGAGCATGATGGCGTGTACTGGCCAGTAACTTTCACCAGTCGTACTTTGAAGTCCAA
CTAGCTCAACTACGGAATCGTCGACAAGGAAGTCTTGGCGCTTTTACGGATGCTGGACGTGAATTACACCTTGCTGACGACGAGATCGATCTTGGTGTTG
TCCAGGCACTCGACGTTGGCTTGGCTAGTCAACTCAGCCGGTTTCCAGGGAAGACTCGGCAACTGGGCTGCGCTGCTCTCAGAGTGGACGTTAGAGATCC
GGAAATGCGCGAAAGGGGAAGATGAAATCCTCGGTGCGATTGCAGCAAGCATCACACCTCGCGCTGAAGTAGACGAAGCGCTGATCGCGATTGCGCCGGT
GAAACAGCCTCGACAAACGATCCTCATGCCACCCCCTACGGTTGAAGCGGACGAGAATTTGTTAGTCGCGAGCTTCGATGGATCAGCGCGTGTTAAACGT
AGCGGTGGGGCTTACAGCGCGATCGTATGGAAGCTCCCCGAGTGGACGATCGTCACCGCCGCGTCGGAGTACATGCCCGATCTGACCGTGAACGAAGCTG
AGTACCGCGGGTTGTTGTTGTGTTTTGATCTGCTGTCGACTTTGGACCGGGGGCGGATCGTGATCTGCGGTGATTCCAACCTGGTGATCCGCCAGATGCG
TGGTGAGATCGCGTGTAAGGCGCCAGGCCTGTTGCTGTTGCGCCAAAAGGCAATGGAGCGGCTCAGATCGTGGCCGAAACACGAGTTCCTGCACATGAAG
CGAGACTGGAATCAGAGTGCAGACAAGTTAGCGAGCGCCGCTCTCCAACGAGAAGAAGGAACTGTGATTACCTCAGAAGATGATCGGCAGGACTTGATCA
CGCTTAACCGTCTGGATGAGCTTCTCAAGGCAAAGGATGACGACGGTATTGTCCGTGTGTCCGCGGTGACTAGATCAACGCGGCGTCGGCAATCGCCGCC
CGAGGCTCTGCAGGAAACGATCGTTCAGCGGGTGCGAAGTGAGCGAGTTGTCCAAGCCCAGAATGAGGAAAAATGGATCACCGACCTAAAGGAGTACCTG
AAAGGAGACGTCGGTGGCTTGACTACGAAGGAAGCCAAGTCGTGTGCTAAGATCGCGGACGATTACGAGCTGGACGAGAGCGACTTGTTGCTCTATTGTC
CATCATCCATGAAGCAGGACGAGGATCGGGATGAGATCGCAAAGTTGGTGGTCCCAGAGACTCTGCAACAAGATTTCCTGCATCACTATCATGCGAGTCT
GGAAAGAGGGCATCAAGGGATCGGAAGAACGTACCGACGAATCCGATCGCATTTTCACTGGAGAGGTCTGTACCGAAGTGTCCAACGCTACGTGGGAGAG
TGCACAGACTGTGAGACAGGGAAAGGGCGACCCTTCGTGAGAGGAGAGTCCCCTGGAAACTTGCAAGCGACGTACCCGTTCCAGATTGTCGCGATGGATC
ACATTCCGTCGTTGCCCAAGTCCTTCAAGGGCAACACGGAGCTACTGATCTGGGTAGACCTGTTCTCGGGATATGTGATCGCGAAAGCAAGCGCGTCAAG
GACGGCCCAGACGATCGCGGAGAATTATGAAGAGTGTGTATTCCGCCGTTTTGGAGCCAGTGAAGCCATTCAGCACGACAGAGAACCCGGTTTTATGTCT
GATTTCTTCCGTGCATTCAGCCGGATCGTGGGACAAAAACAGAGGGCCACGATGGCGTACCGGCCACAAGCAAACGGAACAGCTGAGCGTATGGTGCAGA
CGTTGACTCGAGCGTTGAAGATGTACGTCGCAGACGTTAACCAACAAGACTGGGACGAGTACGCAGAACGCCTCACATTCGCGATCAGCACGACCCAAAA
TCGTGTGCGTGGAGACACGCCGTTCTATCTGATCCACGGATGGGACCCACGATCCACGCTGGAAGCGGCGCTACCCATTGGGAGCACTCGCCGACGTGAT
CGCGAGCCACGACGATGGCGATTCCACATGCAAAGTCAATATTGGCGCGCTAGGGAGTAGGTAAATGAGCGGCTCCGGGAAGCGATCCAGTCGCGGACCA
ACGAACACAACCAGAACGTCCGATCTCAGGAGATTGAGGCTGGTGCTCAAGTCTGGCTGTATCTCGACCGGGTGAAGGAAGGCTACGCGAGAAAACTGGC
GCATATGTGGCACGACCCGTTCCGGGTAGTCGAGATGGTAGGTAATCACGCAGCGAGACTGGAGACTGCCGGCACGGAGTACCGCTTATTCCCGATCGTC
CACGTGTCCAAGCTCAAGCTGGTGCGAAGCT