Description :
From Genome Similarity Track
Location :
Scaffold_109:41369- 48260
Transcript NameFunction/comments
Phypl_g3327conserved hypothetical protein
Phypl_g3328metalloprotease family M48X, putative
Phypl_g3329conserved hypothetical protein
Phypl_g3330conserved hypothetical protein
Phypl_g3331hypothetical protein PHYSODRAFT_484729

Sequence
6891 bases(100 bases per row)
GACGGCAGCCCAGCGCACGAAAAAGTGGAGTACCTCCTTCACGGTCGGCTGCATGCGCACAGGAAGGCGCAGCAGTTGGTCcacttcgtccagcaccacg
ataATCGAGTGTTTCTTCGCTTTCGATCCCCgacgctgcgccgccacAAACGTGTCCATTTCGAATGGGTCCAGTCGCTCCGGCaccttccagctcgtcg
cccttttcacctgctgcgccaccgcaGCGTACAAAACGGCGGGGTCCGTgaacgtgctgcagttgagcTTCACCGCGGCCTTGTTGCTCTTCACCGCTCG
CTTCCGCTTCATCGTTACGGTAGTTTCCAGTGTTTCATATCCCTGTTCAACCAGCAATTCATTCACCGACGAGCTCTTACCAGTTCCCGGGGGCCCAATG
AGGAACAGACTTGCGCCTTGCTCCGCGTGGCccttcagcacgtcgcgAACGATctggagctcctccacgCGTCCGACAATCGGCAAATCACTGCGCAGCA
TCTGCCCGGAGCATATCCGCTGCAGAACCGCCTGCGGGTCCGCAACGGGCTCCGGAATTGCGGGCGCCGTGTACTGCAGCGTTCTCcgcagctcgacgcg
cttgACGACGCTCGTCTTGGTCTCTGCGGCCTTCTCCGGGGTCACGCTCAGCGTGGGGGTGCGAGGCTTGAGGTGGTGCGGGGTCAGCAGCATGGGGGAA
GCTGAGACGTCGTCGGTCTTGCGTTTCTTGGGGGCCGGCGGACTCGGTGGCGCAGAGGAGGgagcgacggcggaggcgctggtcgcctcgagcgcgcgca
gtcgacgctgcagctgctgcgccagctctgGCATGAGTTCACGCTTCTGGGCTCGCGTGCGCATTGTGGAGATTAAGGGGAAAGGAGGACACGGCACAGA
CAAACAGTTGAGCTTTTCAAGGCAAATGCGATTGTGATCGAATGGCGCCAAGCGCAAATTGGCGCGAAAACCGAAATGCGAACGCCGCATTTGGATTGGG
GGAGAGGAGCGGATACGCTCGCTGCGATTCGCTGAAAAGGAGGCGACGGTACCTGTTGGATATAATGCCGCGTCGCGACAACAGGAAGGTGGAGGGATTT
GTGATTCTTGAAAAGAGGCCGTGGATCAGCACGTTCTGGAGACGACGATTGCGATTTTGAATTGTTGGGGAAACCACCTTGACGTTCATCAAAGAAGTCA
TGGCGGGCGGTATTTTTGCCGTTGGGAATTGACATGGAATTCGTGAATTGGATTGCAAGAACGACAAGGCGAACGCGATCGAGTAAATCACAAGGCTAAA
TTTTATAAGTTACAAAATGTTCTGCGCTCGAACCGATGCCGATCTCGCATCCCGACGAAAGCTCAGCACGTATCGTTTCCATCGCTATCGTCCTCGGTGG
TGGCAatgagcttgagcgtctcAGCCGAGGTTAAGAGCTTCAGCCGCTCGATGCGTGAGGTCAGCAGCGGGTGCGAGGTGTCGCCCAGGTAGTTGCCTTT
CTCGGTGATCATCCACGTGTTGAGCACCGAGCGCACCTCGCAGTTGCGGGACAGCTTCCGCTGGAAGCAGTTGATGCCGCCGCGCGCGAAGCCGCTCTCG
GCGGCCACCTGGTCGGCCTCGTGCTCCAGGCTCCAGGACAGGTACAGGTTGCCGCCCACGATGCCCAGCACGCCGACAATGCCCGCGACAAGTTTGTTCG
GGATCTTGTGAATGGCGACGCAGCTGCCGACGAGCGACACCGGCAGGAAGGCGCCCGTGTACATGGAGTGGTTTTTGGCGATGTGCGCACTCTCGTGCGC
CAGCACGAAgtcgatctcgtcgcgcttggGGATGTCGTACTTGGCGTGCAGGTGCCCCGgcgcgaagaaggcgtcgtaGAGCTCCATGGGCAGCACGATG
CATGCTCCGCGTTGGCCGACAGTGAGGTTGGCCCCCATGGAGGCGCCCGCGGACTGCTCTCCGACGCGGATGGAAATGCGCTCCGGGTTCTTCACGCCCA
CGCGGGCCGCGATTTTCCGCACGTTGATGGCGAAGGGGTCTTTGCGGTCGAGTTCATGGGCGTCAAGCCCCTGCGCCAGTCGTAGCGAGTGCGTGCTGGT
GGGCTCCGCGATCGGGTACGACGCGTATCcgtagagcagcagcgccgacgcgccgATGAACCGCTTCGAGTACAGAGCCGTCGACATGAGCTTGATCGTT
GCTCGGGTGGCCAATTTCCAAATAGGCTCGCCGTCGGGCGCCCGTGCAGGTGCAGCCCACATACTTGGTAAGAAGGTATTACCTGTTGCCTTGGTTCGGT
TTGCCTGTTGCGTGTTTTTTTCAGCAAATTCGGCGGTCCACGCCTTTGCTTCGCTAGTGACTTGGAATTGTATGCTGCTCGCCTTTGCTGCCGGTGATTT
GCCTGTTTCGTGTCTGGCCCACCGGGATCGAGCAGGCTCCAAGGCGCTCGACGACTCTTGCACGCACCAAGCTTTGGTTTGTGTCAGCACCAACGCTGAG
GGCATAAAGtgtcctcgccgctgcaaATAGCCCGAGGTGCTGCGGAGGCTGGGAATACCCGTCTGGCCATCACGGTCGCCCTGAGGTTGTGGCACAACTT
TGCGCAACGCTCGATGACGCTGGCCAGTGAAATCGCATCAGACTAACCCCGGGATTGGCTGAACACGGAGTGTCACAGCCCCGCTGAAGTTTAGCCATCT
CGGTggtctacatgtacatgtacacgaaGCTGCGCTTCGACCAGCAACTTGCTCCCAACAGCGGCTCAACAATTGCACCTTCCAACTTGGTACTAAGAAT
CTTGCGAGCTATCCATTGGCCTCTCTAAGCTGGCAGTGTTTTATACCCGGGCAGTGATGAGCGCATTTGCTTGCTCGTTGAAAGTCCAGCGCATTGTCGT
TGCAGTTGCCTGTATTTCAACTAACCTTTGCTATCCAGGGAAGCACGGGTCGTGACTTAACTTAGGATACCGCTGCTCCACTGACGTCGTCACGACGAAG
CGAATTTGTCCATGTATTTGTTGTGGTCCAAGAGGCCATCGCCGTAGAAGAGTTTCCCGACGAGTGCGTCAGGACCAAGTTcctcgaagcagcagaatgC
TTAACAATGCATCTCGCCCTTTCAGAACTCTGTTGTCTGGGTAATAGAAACTCTACATAAGTTtaccagcacgagcgcccCGACAGCTCTTCAAAGCAGG
CACTGGGAGAATGAATGCTTTGCCTTTTGGTGCACAGAGTTTCAACTGCATAATGGTACcatttaaaaaaaatcgCGACGTTCTTTTCAACTACAAAGTT
ACAACTATGGCTCCTGCTTCCTTGCGTGCCTGAAGTCCTGCTTGCCGCTTTTGCAGTACGGGCAGCACCTGTTCGCCTCGTAGTCCGGGGAACGCTGGTC
CGCTGCGGTCAGCGGACTGCGGCACGTGAAACAGGATACGACCGCCGCCTCTGTGAGATCCGGTTTGAGCGCGACACGATCGTCGAAAATATAGCAGTCG
CCCTTGTAGTGCGCACCGCCCACTTTCTCAAAGTACTTGAGGATGCCGCCATCCAGTTGATAGACCTCCTTGTGGCCTTCATTCAGCAATGCATACGACG
CCTTCTCGCACCGCACACCACCAGTGCAGAACATCACGATCGGCTTCTCCTTCGgcacctgctggagctgcgctcGAGCTTCGTCTGGAAACGCGCGAAA
GCTTTTAAGGTTCAGGTCCACTGCGTTCTCAAACGTGCCCAAGCGAACTTCGTAGTCGTTCCTGCATCAACGCGATACTCAAACTCAACGTCAGTTCCTC
CTCTCATAACCACGACAACCGTCAAGCTCTGCTGGCGCACCTTGTGTCCAAAACAACCATGTCTTTTCCGTCATCCATCCACGCCTTGAACGCTTCGGCC
GAGATGTGTGCCGCCAGCCCATCCACCGCTGGCTTGACCTCCTGCATGCCCATGGAGATCACCTCCCTCTTGATCTTCACCAGCATCCTCGGCAGCGTCA
TGCGCTCGGAGTACGAGTCCTTAAACGCCAACCCGTGGATCTCCGAGTGCAGACCAGCGATCGCGGCTTTCATGGCCTCCACAGCTTCCGACGTGCCCGA
CAGCCGAATGTTCACTCCTTCAGCAGACAACAAAACCGTGCCGCGAAGCTGGTCCTCCCCGAAACgagctgcaacttgcagcagttgctgcttgaGATCG
GGCAATCGCTCCGGGGCGAACACGCAGAACCCATAGGCCGACGAGTTCACATACGACGCCTTCGGCGAGTGCTCCATTTTCCAGCCGCTCGTTTAACACC
AACCTTCTATTAGGGTGTTTGCGGTAAAACAAACTTTTGACTACTTGAAGTGTCAATTTGGCACTTCCCAAAGTCTCACTGAAGCGATCACGACAATGGG
CCCCTCTCGCCAGTGGATGGAGACGCCcagcgtggtgctggacgagaagcgtctgctgcgcAACATCGAGCGgatgcaggcgctggcgacggcgaacCAG
GTGAACCTCCGCCCCCACGCCAAGACGCACAAGACGCGGGAGATCGCCGCGATGCAGTTGGCAGCTGGAGCTTGTGGCCTCACCGTCTCGAAACCATCCG
AAGCGTTGCGGTTCCTGCGCGGTGAAGTGCCGGGTCTCGAGAGTCTCATGCTGGCGTACCCGGTGGTGCAGAGCAACAAGGTGCAAgaggtggtgaaggc
ggcgcaggaggtTGGCGTGGAGTTCCTGCTGACCGTGGACAGCTCCGAAGGAGTGGACGCTGcgcagaaggcggcggaAGCTTGTGGCTGCActttgaag
ctgctgatccACGTTGATGTGGGATACCATCGCGTGGgtgtggaggaggaggacccgAAGCTactgcagctggcgcagcggaTTGACAAGACGAGCAGCC
TTGAGTTTCGCGGACTGCTATCCCACGCAGGTCACGGTTATCGCTGCAAGTCCGTTGCTGAATGCTCCGAGgtggcggagacggagaggAAAATTATGGT
TCGCATCAAGGGCACGCTGGAGGCCAATGGAATCACTGTTCCTATCGTCTCCGTGGGGAGCACCCTAACTGAGCCTGCTCGTAAGAGTTTCGTGGGAATT
ACGGAAATCCGTCCCGGGAACTACGTGTTCCTCGATCGCACACCCGTGCGTATGGGACTGTTTTCGGTGCAAGATGTGGCGTTGACTGTTCTTGCGACGG
TCGTTAGCTCGAATAAGTACAACTTCATCGTGGATGCTGGTTCCAAGGTGCTCAGCTCCGATGGCGCGCGATCGGCCGGCGAGTTTGGCTCGGCCTGCTT
CGGACTCGCATTTTACGAGAAGGATTTTGAGCGTGTGGTGAAGGAGCCTACTCAAAACAAGACTCTGCTCGACGATGGCAGCGAACTGGTCTGCTTCGAG
ATGACCAGCCTGTCAGAGGAGCACGGGTgggtgaagaagatcgaaGGCGTTCCCTCGCCCGCCATTGGCGAGCGCCTCGTCATCGTGCCTAACCACGCCT
GTGTGGTTTCGAACCTCACCAACAAGTTTTACGTTCAAGGCGAGGAGCCAAAGAGCTGGACTTTGTTGTCTCGTGGATGCACACAGTAAGAGGGGCGTGC
TTGTTTGCGCGGAGGAAGGTCATCTTACGCACAGAACTCAAGACAGATCTCAAAAAGGGAGCTGTCTAGCTCTATTAAAACCATCGCAACTGAAGGTTTT
GAACAAACTCGCGGTTCGCATTATCTTCCATGCGCTGGATCAACTCCTCTTTCGTCTGCGGCAATTTACTGtccgcgccgccgtcttTGGCTCGGAAATT
CCTGAGCATTCGGGCTGTAGCTGCCTTAATCACTTGGAGCTCCTGCTTGTGTGTTGTCATATAGTGGTCGAACGCTTCAGTGTGCAGATGCGAGTCGTGT
AATGACTGTGCCCACTGCTGCTCATAAACCAACTTCAAGAGGTGTCTGCGAAAAGGAGATCGCAATACTTTGGTGATCATGGCCCTGAATGCCGCGTcat
ccacatctgacgatTGCGTCGCAGCATCCGCAATGCTCTGATAATACGCAGCACTCTCAGCCTTCGCAGTAGGTGGTGGCGAGTGGTACATCCACGTAGT
GAGAGCAAATCTTGGCCTGATGGCAGGCATCACGCGATGCAGCATTTGCTGCGACGAAAACAGCACCAACTTGCCGAAGCGCGGCTGCACTACGACCCGT
GATTTCGGGAACGGGTAGATCACGATCtcgcctccgtctcctgctTTCCACTCCTCATTTAAGTAAAGCACAGCCGTCACGcacttgccgtcgtcgccgt
aggTATCAAAGTGCATTGGGAAGCAAGCCCCCCGCCCAGCGTTGTGCTGCACCTTGACCATGTGTCCTGTCAGTCCCAACCACTCCGGTAACGCTTGACG
TAGGGGGCCAAAAATCacttgctgctcgaagaaATCCCTCAGGAATGGCACGGACGCCTGGTCCCGaatcgcctccagcgccaactcCGTCTCGAGGATG
tcgtgcttctccagcagcagcgtcttggtcgtcggTTGGCTCCGGTCACCACTTTCACCGCCTTGTGGTGTGTCATTTAGCAAGATATGCGTCGAGTTCG
GGTACAATTGGCCACTCgtacgcagcagcttcatctcgtcgCGAAGGTGGCCGAGATACTCCACTGGGAAGGCGTCGCGCACCACGAAGTAGCCATCTCG
AAGTAGGCCGCTCACCAATTCTGACGTCACGGATGCATCCCAATTGGCGCCGACCCGGAGTTGAGCTGGGGCTggcggctgcagcgatgAGAACGGCAAG
CGACCGGCGAGGCGCTGGAACAGCATTTTGTAGGGCTATCCTTTTGTTCGgaatactacatgtactgtatgCGATAGTGCAGTGCCGCGCA