Description :
From Genome Similarity Track
Location :
scaffold_39:41362- 42641
Sequence
1279 bases(100 bases per row)
GTCAGCGGAACATCACTCGCTTTAATGAGCAATTGAAttataaccatcgaccaagtcgagtgcactgtagtttgtacatccaaccatattgttctggaga
acatccttcctgggattcggcgtctgtgtcggaatAATAGTAGCGTTAAGctttttgtaagcgtgaacgataacccacttgccgttcgggtcccggacac
aaaacgagGGTatcaaatggggagacttactctcacgcccGAAtcctgcatcgtgctttgcacggaaggaggtgtcaatgacgtcacacagctccttggg
caggggccattggcgtgttacgcagtattcgaTTCcctgaaccaggtcgatctcacgaCGCATACATGAAtccggcgggtctttggagacgacgtcttga
aatttcattacgaaaggatagtacggatccgaatgATTTTTATGAAtggaagatccacttcgtgcgttcagcaccctcttggtgaccttcaggacagctt
catccagaagtgcaattaatctcctcttccagtcgtataatgaccactttggccaagtggcctgccttcaaggcaccgccaaactcttcgaaggatatct
cgtccagttcaagaagagcatccaccgcgggaataacctctagggtgacgtcgccgtctttctctcccgtcagaccgttgacgagggtgtacaggtgtgc
gctatcgtctacagtagacacatcctcttcgtccagtggataatgcGCCATTCCACGCGAATCTAAAGGGCCTTGcatcggacctcgtccgaccatgcca
ctcgtggcatgcagcaacagctTCGAAGCGTGAGCAGTGCCTCAGTGAAttcatgccactccacgtgcatcactggggcttCGCCCTCGATTCCTCGGAC
CtcttccgaccatgccactcttggcttGCAGCGGCTGCTTCgacacttgagcagcgctcagtgggttacgtgctcCACATCCAGCCCTCGAGTCATGATC
AGGACTTCAGTGCGATTaatcttcggtgttcgacaactcggatactccaatcTCCAGCACGGTAACCGTCCCAGTTCAGTGTTCGCGCCAATATTGGCTC
TACTTCCTAGCAAAGGCGGGTTCTTAACTCACCAAagttccaccaggagacgtacgCGTaacacccaagatcttcaacctccaatcgatccatggctcat
ggtgatccaaccatgccatactaaGGAtggggtcataccttgaatccaaatcTACGACTAAGCAGAGTTCCACGCTAtc