Description :
From Genome Similarity Track
Location :
Scaffold_135:4136- 7917
Transcript NameFunction/comments
Physo_143308reverse transcriptase

Sequence
3781 bases(100 bases per row)
CCTTCCACTCAATCAAATGTAAATGTGCAACAAATACCATCCACCATTACGGATAGCGTCCACCACGCTACCCCCCAACACCGCCTCACTCTTCGGCGAT
GTCGGCCTCTCCACGCGATTGCATCACATGGAACCTCTGCCGGCTCCGACGCTTCTGCTGGAAGTCGAACAGCAGACCACCACAGTTCAGGTATTCTTCC
TTGACCCAATTCGTCTCTGCGTGGCCCTTCCAACGCACCAAATATTCCTTGAGCCGTCGACCGTAGCGTGTGCGTCTTTCCGTCTTTACATCCAAGATCT
CTTCAACTTCATACTCGTTGTCACCGCGAGTTTGTGCCTCCCAGCTATCCTCGGGGAGAAGTTCTTCGTCAAAGTCAAATCGTTCGCTTTCATCAACAGT
GCGATCTTCGGCGGGTCGTTCGGGGAACTGTCGGACCAGCTTCAGCTTCGAGATGTGTACGATAGGGAACAGTCGGTAGTCAGTCCCGCTGATTTCCAGC
TTGGCAGCGTAGTCGCTTACCATGGTGGCGACTTTGAAAGGCCCATGCCACATGTGAGCGAGCTTCCGAGCGTATCCGACCTTGACTCGGTCGAGGTACA
GTCACACCTGCGATCCCTCCTTAATGGGTGACTCCGGTACGTTCTCATTGTGGGCTTCCGCGCGACTCTCACGAGCTTCGGCGAGGAGACGACGAGTCTC
TGTCTGAGCACGTTGGTATTGGCGTTGGATCTTGAACCTCCATTTCTGTGGGTCGAGATCTCGGCTTCCGGTCCCTCCGGCTTCGTTGTGCCTTTGCCAC
AACGAAGCCGGTGAAGAGATCCACGAAGACTAGGAGCTCTGTGTTGCCCTTGAACGACTACCGGCTTCGTTGTGCCTTTGCCACAACGAAGCCGGTGAAG
AGATCCACGAAGACTAGGAGCTCTGTGTTGCCCTTGAACGACTTCGGGAGGGTGGGGATATGATCCATAGCCACGACCTGGAAAGGGTAATTAGCGGCGA
TATTGCCCGGCGATCGCCCCCGCAAGGTGGGTTTTCCTTTTCCCGTCTCGCAGTCGACGCACTCCCCGACATACTTCTGCACACTTCGGAACATACCTCG
CCAGTAGAAATGCCTCCGAAGCTTTTGGAATGTTTGGCTGACTCCCTGATGACCTCCCTCCACACTTGTGTGGAAATGATGCAGGAGATCTTCGTGGGGT
GTACTCGGCATTACCAGTTTCACCATAGATCCACGGTCCTCGACATCACCACCGCGCCCCTCGACTGGACAGTACATCAAGAGGCCATGCTCGTCGACCT
CGTAACTGTTAGCCAGTTTACTGCACGTCTTGGCTTGACGGCTCGAGATCTGAGAGAGATCACCGTGCAGGAAACGCTTCAGTGACCAGATCCACACCTC
CTCGTCTTGAGCACGGCAAATACGTTCCAAGCGCAGCTGCTTGACGACGTCTTCCTGCAACACGGCTGGTGCGACAGTACGAGATCGGCTTCGCGTGACA
GCGCCTACCTTCGGATGGGCGTCACGTTCTTCGCGCGTCTTGAGGAGCTCGTCCAGTCGATTCAAGGTCTCGAGGTCCGTGCAATCGGTGTGACTCTCGA
CAACTACCCCGGCACCACGCGTGCAGCGCCTGTCCCGCCAGCATATCCGCGGGTTGGTTCCAATCGCGTTTTACGTGGATGAGTTCGCATTGCGGCCAAG
ACCGCAAAATCACTCTGGCCTTCTCACGCAAGAGCTGGAGTCCCGATGACTTGCACTCCATCTCTCCACGGAGTTGGCGGATGACTAAATTGGAGTCGCC
ACACAGAATGAGACGGTCGATCTGGAGATCGGCAATCAAACGAAGTCCGAGAAGGAGGCCATGGTACCCGGCCTTGTTCACAGTGTGGTCCGGTAAATAG
CCAGATTCAGCCTTGACAACCTTCCATCCAGGAGCATCCCATACCACAGCGCTGAAAGCTCCACCAACTCGTTTCGGCTTGGCCGATCCGTCAAAGCTGA
CGACGCAAACGTTTTCTCCGGGCGTAAAAGTCGGCATCGGGATAGCCAATGCTCTCGTCGACTTCTTCTGCGGAGAGATCTCCTCCAACGCTGCATCCAT
CTCTGCGCGCGGAGTGATACTGGCGGCAACCAAACCTAGTAGCTCATCTTCGCCTTTCGTTAAACGTTCGATCTCTAGCGAATGGGGGGAGAGCAGCGCC
GCCCACTGAGCTAGCCGTCCCTTCAAGCCTTTCGCGCGGAAGAGCCATGCGAGAGTCGTGTGTCTGGTGAGCACTCGGATGTATCGACCACTCAGCATGG
TGAAGCAGCTATCGAGGGTTCTTAGCAGAGCCAGTACTTCCTTCTCCACAATGTCGTACCCGATATCGTGAGACCGCAGTGTCCTACTCGTAAATTTGAC
GGGTACGTACACTCCATCACGACACTGAACGAGAGAGGCAGAGATCGCCCACTTGCTTGCGTACACAATCACAACAGGATCCAACTCTGGGGCAAAATGG
TAGAGCATGGGTGCGTTGATCATCTTGAACTTCAGGGTATCGAAGGCTCGTAGCGCGTGGCCCCATCTCACAGTCGCCTCGTGATTTCCGCTGACGTTTG
TGGCTCGACCCTTGATGAAATCGGAATCTCCGAACTCATACAACACTGTGGCATATACTGCGAAATCTTCGATGAAGCGATTGTAGTAGTTGAGACTGCC
GAGGAATGACTGGAGAGCCTTAAGCGTTTTGGGAAACTTCAACGCCCCCAGACTTGCCAAATCTTTCGGCTTGGTGAACAGGCCTTCACCGGAGATCTGA
TGCCCCAGATAGTCGACTTTGCTCATACCCCAACTGCTCTTCTCCGCGCTAATAGACATATTCCAGCGGTCACAAACCTCGAGGATCTTCTTGACCTTCT
CACACAGTTCGTCCCACGAGCTTGCTCCAACTAAGATGTCATCGATGTAAGAGCGACGCCCCAGCACCGACGGCAGCGATCGATCTTCAGGAACACCGTC
CTCGAAAATGTTGACGAGATCCGCGCGATCTTGACCCGGCGAGATCCGCAGCACGCCATATAACGCATTGTCGATCAGCCGCTGATAGATTTGGGGGGCA
TTCTTCAGACCAAACGGCATTCGCAGCCATTCGAACAGGCCGAACGGCGTAATGAACGCGGAGATCTCTCGGGCTCGATCGGTCATACTCACCACCCAGA
ATCCACTCGCTATGTCGAGAGAACAGAACCACAGCAAACTGTCGAGATCATCGAGGAGGTCGTCAATCAACGGCATGGGGTAGATCATCAGTCGTGTCAG
AGCATTGACCAGACGGTAGTCGATAAAGAGTCGGACGTCCATGCCGTTCTTCTTGACGACAATAACGATCGGAGACACCCAAGGAGAAGTGGAGATCCGA
ATAATCTTCGCCCCCAGTAGCCCCTTGACGAGTTGGAACACCTTTTCACGGAACTGAGGCGGGATCCGGCGACAACGCTGAGCCACCGGTCGTGCACCAC
CAACGTCGATGTCACAGATCGCTCCCGTCGCCGCAGGGGGTAAAGCATTCCCTTTGCCGATGAGAAGGTGACGCCGCTCCCAAATGATATCACGCAGACG
ATCAATCTCCTCTGCTGTGTTCTCAGTTGGATCCCTGACCTTGAGATCTTCCCTTTTAACTTCTGCCGTCAGGGAGATCTCTGGTAACACCGTCATCTCC
TTTTCGATGTCTTCCGCAGTGAGATCGGCCCCTTCATGAACATACTTCGCTTCATCCATGTCGGTTGCATCCCCGCCTTGG