Description :
From Genome Similarity Track
Location :
Scaffold_16:41355- 42660
Transcript NameFunction/comments
Physo_309347Hypothetical protein

Sequence
1305 bases(100 bases per row)
ATGCTGGGTGCTTAGCTGGTGCAAGATGGTCTCGTCGCACCGCGCAGCGATAATACGCACGATGATCGTGTCGTTCGTGATGTTCACGATGGACCGCAGG
CGATCTAGGATCCAGTCCGTACTCACAAGAATGGAGAACACCACCGGCACGTCCACGCCAAAAACTGTTCGCCACACCGTGAGCACCATCACCAGCCCAG
CGTGGGGGACGCCAGCGACACCAAAGGAGGCGATAGCGCTAACAAAGCCCAGCAGCACGAAGCGTAGCGGCGTTAGCAAGGCGTCATACCCACCGACTTT
CGCTAGGAAAACGCAAGCCAGCGGTATGTACACGGCTGTCCCGTTGAGGTTACTCGTGGCCCCCAGAGGCAGCATGAACCGCGATAATTGGTACGATACT
TCTCTTGTAGCGTCCACACAGCGCATGGTCATCGGCAGCGTTGCGATCGAGGATGAACATCCAAAAATGAAGATCTGGGCTGGAACCATTTGCCACAGGT
GCGAGAAGATATTCCTCCTTGTCGTCACGAAAAGCGCGAGCCCGAAAACTCCGACAGTGAGCGTAAGAAGGGCCACAATCAAAGTGCCGACCAAGAAGGC
GACGCCCTCGACGAGCTCCGTCGATGAACTGTAGCTGGCAATTGAGCCCGCGATCAACGAGATGACAGCGATCGGGATGTACTTCACCACGATGTTCACG
AGGAGGAGGATCACTGCGTTCGCGTGCGTCACCATAAGCAGGGGGTAGTTCTCCACGCCTGCTTCTCTGTCCACACTCTTGACTAATGCCACTCCCACCC
AGATAGCGAACGCGATAACGCTGAGCGTCGAAGAGCCCGCAAATGACTCGAAGATGTTCTCCGGCACCAGGTCCTTCACGATACTGAAAATCTGCTCCGA
GACGTTCAAGTTCTCGAACTCCGTGTCCGACGTCTTCAAGTAGCCACTCACATCATCCATCACGAACATGTTGCTTGACGACGTGCTGTTAGTTGAGCTG
CACGCGATCGTTCCATTCACCAAGTACGAGAGATAGGAGCCGTCAGCACACTGGAATGTCAGCGATGGAATAGTCGGCTTGATCGGCACCACGGCGCTTG
ACGGATAGAGGTGCGACATCGCAAAGGCGAAGAGGGTGCCAGTACACGACGACGCGATGGAGGCCATAGCGAAGGAGGTGATAATACGTCTTCCGATGGA
CGCAGCCTTGCCAGCCTCCACCAACTCTCCGATACACACGATCACACTGCAGAACACCATCGGAGCCACCAAACACTTGAGAGCTTGGATAAAGAGGACG
CCAGG