Description :
From Genome Similarity Track
Location :
Scaffold_266:4135- 6837
Sequence
2702 bases(100 bases per row)
TATGGCTTAAGCAAGCCAACGTAAAACGATGGATATGTGCGCAACTTGCGCGGAAGATTGAGTGTATAGGCAATGCCCTTCTTCGCTATGACCGTGAACG
ACCCGATGAAGCGTGGGCGCAAATTTGTCTTGAAGACGGCAGACACTACATTTGTAGGTAGGATTTTGGCTTTTAATAAGACTTGGTCTCCAACTTCATA
AGAATCAATACATCCTCTGCCTTTATAGCATCAGCTTGTTCTTTTTGTTTGTCTTGGCTATCATCCATTGCATCACGCACGTGTCGTAAGACACTAAAGC
GCGTAGCGAGAAACTCGCTCACTTGTTTCTGCATCGTGGTAGGGCTTATTTAAGCAAGCTTGTCAGCAGACTCCCCCACCCAGCCCAGAACCACGTAGTG
GTAACATGAGCGGAACGCGGGGGTGCGTGAGGCTATTCAAATAGAAGGGAGTAAAGCCGTTCAAGGCATGAACAGCGTTGTTCAACGAAAACTCAATGAC
AGGGAGCATCGAGCTCCAAGTCTTAGGCGAATCAGCACAAACACTGCGAAGAACGTCAACAATGACACGATTAACTCGCTCAGTCTGAACATCGGTCTGC
GGATGATCCGCTGTGGACATGTCCAATCGCGTGCCAATCACCTTGAAGATGGAAGTCCAAAACTTGCCTGTGAAGCGAGGGTCGCGATCAGAGATGATTG
CTAGCGGCTACCCGTGTTGACGAAACACACGATCGATAAACAGCATAGCTGTACCTTTGCCATCGATGGATTCCGGCACCGCCGCTAAGTGAGCCATCTT
GCTTAAATGGTCAACAAAGACCACAATTCCCGTATCGCCGTCACTGTCTTTGGGAAGACCAAACACAAAATCCTTACTGATGGACTCCCAACACCCCGTG
GGCACAGGTAAACTGGCGAGTGGCGCAGACGAACGTGCTGAGGGTTTTACCCGCTGGCACGTTTCGCATTTACGCACGTATGTGATCACCCATTGTAGAG
TTTGGGCCACCAGTAGTGTTGACTCACATAGCATTAAGTCTTTTCCCGGCCCAAATGCCCACTGAGGACAGTATTGTGGGCCTCAAAGAGGATTCGGCAC
TTTAAATCCTCATTGTGAGGTATGACAATGCGAGCGGTATCCACTACATCTTTGCGATAGCACAAGAGGCCATTATCGATGGAATATCGATGCAGGCCGA
CCCGCAATCGTGCCGATAATTAACTGTCCGAGTCCTTGTATTCCTCACTCCTAAGGGCATGAAACAATGCCACACATTAATGATCCCGTAAGTAGTCCAC
ACGAATGATCTCCTCAATAGGAGACGACAAAGTCGTGACATGAGCAAGCTCCTAATCAGGTTGGTGAGAGAGAGCATCTGCCAACAAATTTTGTTTGCGT
GGCTTATAGTTCACCTCGAAGTTATATTCCGCAAAGAAGGAAAGATACCGAGCCAATTTCTGAGAGAGGTGAGGTGACTGTGTCGCCGTGCGTAATGACG
CATGATCCGTATCGACGACGAATGGCTTGGATCCAAGCAGATGTACTCCAAATTTGATGAGCGCATACTTCATAGCAAGTATCTCTTTGTCATGAACTGG
ATAGTTCTTTTCAGCAGCTTTCAGCTGACGAGATTCAATGCCATAACTCGCTCGTGGCCTGCAGAATCGGTTTGTAACATAGCTCTTCCTATGGGCAAAG
TTGGATGTATTGCAGACAACACTGAAAGGGTACTCAGGATTTGGCAACGCCAAAATGGGAGCACGGAGGAGAATCTCCTTCATTGCCATAAATGCGTCAG
CATGGGTGTTGTCCCAGTGCCAATCTGTGTCCTTTTTAATGAGATTAGTTTATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGTAAAT
GGCAAGGCCAATTCACTTACGCAAGTCCTTTTGATTCTTAGGAATCGACCAGTTCACTATATCGTTGATTTGAGCGGGATCCTTTCTAAGGCCGCGCTTA
CCAAAGAAACATCCTAGAAAAGGAATCTCTTTTGCACTAAAAATGCATTTAGATGCGTTGGCGTCCAATTTATTAGTGCGCATGCACTCGAGCATGGGTC
GCAAATGATCGATGTGGTTGTCAACATCTGACGGACCTCGTTCGGAACGACTATGGACGACAATGTCATCAATGTACGTCTGTGCACAAGCACGGTAAGG
GCGTAAAAGTTGCGTCACCAGACAATTAAACGTAGCCGGGGCATTGGAAAGCCCCTGGTGCATAACCAGCCACTCCCAAAGCATACCGCTTGAAGTACTA
ACCGCTGTTAGCGGAATATCACTTTGCTCGCATGAGCAGTTGATAATAACCATCGACCAGGTCGAGTGCACTGTACATTGTACATTCTACCATGTTGTTC
TAAAGAACATCCTTTCTAGAAATGGGTGTTTGTGCCGGTATAGTGGCCGCATTAAGCGTATTGGAAGCATGCACAATGCGCCACTTACCATTAGGCTTTT
GGACACAAAATGTCGGCGTGGAATGAGAATTTACTCTCCCGAACCATTCTCACCTCGTGCTAAGCACGGAAGAAGTCATCAATGACATCACATTGCTCCT
TAGGCAAGGGCCACTGTCGTGGGACACAGTATTTAGTCCCAGGAACCTAGTCCATTTCATGACGGCCACCTCTATCTGGAGGTGGAACCGAGGATGGGTC
GT