Description :
From Genome Similarity Track
Location :
Scaffold_5:413435- 418131
Transcript NameFunction/comments
Phyci_76652serine/threonine protein kinase

Sequence
4696 bases(100 bases per row)
CTTGCGGCTTGCTTTCGGTGGTGCGAGGGACATCATGTCGTACCGGTCGTCCACCATGCTGTGCAGGAGGATATACCGCTCGCGCCCAACGCTGCGCGAG
TTGGCCTCGGGGGTAAGCGCCAAGACCTCTTCCATGGTGTATTTGAGCTGCTTCCGATACCGAGGATTGTGGGCGCAGACGGTGTCGATTCCGGCGCGAC
CTTCTTCCATCAACGCAGATGACATTTCGCGTACCAATGCGAACGGAAGGTCCACGGACAGCACCTTCATGGCGTCGTCCCCGCGCGACGAGAAGCTGGA
CGAGATCCACTTGGACACGCGACGCGTGACTTTCTGCGTGTCGAGCTGATAGTTGCGGTAATTCCTATCCCTGGATTGGTACTTCGCATCCACCACCCTC
ACGTCGAAGATGGGCTGCAACGTGCTGCCCGATGACGAATTGCCGCCGCTACCACCGTTGTGATTGTTGCTTCCACTGTCTCCGAAGTGGTTGTTGCCGC
GCCCACCTCCGGTTGCAGTGTCGCCATGGGAGTTCTTGCCGAAATTATCCAACAGTCCACTGATGTATTCCGGCAAAGCTGTCACGTTCGTCACCACATC
AGCTTCGGAATGACTTTTCACTGCACGGATCTTCACCTGCTGCTTCTCTCGCATCATGTGCTTTTGCACAATAACCATCCAGTGTACATTTTGTTGCGCG
CAGTAGTCCTCTAGGTCTTCCAAGTGGAGCGGCTCCGGGTGCAGGTAATCTGCACCGATACCTTGCCCCCACAAAAGCGTAGCGATCTGCATTCGAAACA
GCATCGTGTCGGATGCCTTGCCTGCCGAGCAAATCAAGACCTTGCGGCCGCCCGTCAGCACCTCTGAGGCTGGAGACTTAAATTCAAGCAGCGCTGGGCA
CATGGATTCAGCAAGTAATGACACAATCTTGTCGATGGCAAAGCGCACACCCATCGCAGCGACTGATGAGGATTTTGCATAGGCTGTCGTGAGTTTGAAG
CGCGAAATCAGCGCATCGTAGCGTCCTCCTTCGGCGACAATAATCTGGTTATCCGTCGTCGCGACTAACAGTGAGGCGGATTTATCCGCGTTGTTGCCAC
CGGATGAGGGCTCATCCAACAAAATCGCCTGGAAGATAAATCCTGACGTGTATCGTTCGGGGCGTGGACTAAGCCCCAAATCTAATCGTGTGCACACTGG
ACCTGATAGCTGGAGGAATTGCATGCCTTGCAGAAGCAAGCGCAAGGATGTGATGCCCTCGTTTACATCTTTTACAACGCGTCGCAGCTGCGCGTCTCGC
TTTTGAATCTGTTTTCGGTCTGCTGAGGAAGACACAGAGCCACCATCACCATCCGATGACGAGTCGCGATTCGTAAGAGCCCGATTCTTCGCAAACAACT
TCTGTATCTCGAGCTCGATCATATCCAGCGATGTCAGACAGTCCTCCGGCAATAGGAAAAACGGTTTTAATGCGTCGATGGCGCTTGCTGGTGCACCATA
ATGTTTCATCCGTTTCGCGACGAATTTCCAGCGTCCAGGTTTCAGACTTGGGGCTTGCGTGGACGGCGGGCCAGCATGGACGTAGAAGGAAACTTCGTTC
GAAAGCAGCCGCAGCACCTCACGACGAGCACTGCTGGGAACGCGGCATAGGTCAAGAATGCCGCGCGTCATCCGGGCGTCATTGAAACGCATATAATAAG
ATCCCAAGCAACTCGGCAGTGCTTTGATCACTCCAGATACCACTTCTAGGCCTTCCAGTTCCAAGAAACGGAAGGAACCCCCATCATCCCAGATGATATC
GAAATCAGACTCCGTGAACTCGCGAGGATGACCGCCACCCACACTTTTCCGGTACACTCGGTCAAACTGAAAGCACTTCAGCCGCGAAACATTGTGTCGT
GCCACGAAGCGAGCAAGCCTTTCAGTTAGATCGAACGGTAACGATACTGAAACGCCATTACCATCCAGCATCATCGACGCGTTAGGTGGCGCATTAAGAG
TGATGCCGTTAAAGGTCTGCTCTGACAACCGTGGCATAAGCAACGGAGTTGACATTTCCACCGCTCCGTGACGCTCAAACACTTTCTGTAAACAAACATG
ATTAGACACACGAAAACCTTTTCCGTATAGCTACACGATTCCGTACCTGTAGGACATTCCTGACATACGTTTTTGTGCGCAACTGAACCTCGTAGCTGCG
CATTTTGACTGATTCCAGGTGATCGTAGGTGTAGTCAACGTGGTTAAGTGGTTCTTGCGAAACCAGTGCATCGATAAGTTGCCCAAAGAACTTGCCCTGC
GGGTTGGCCAGGGTGTCCAGCGCCTCGCGAAGATAAGAACCTTCTACCTCTATCTTCGCGGGCAAAAGTGGGCTTGCCAGCAACTCCTTCGCGTTTGGCC
GTTTAGACGGATCACGTTCACAGAGCCACAAAATGATCTTTTTTACATCGTCAGAGGCACTGAAAACCGCTGGTAACTCATGTCTTTCCCTCAGGCCAGT
AAGTGCCTGTGCACGCTCCATCAATGTCGTGAATGGTGGCGACCAcatctcgaaaaacatgataccaagcgagaacaagtctgctttctggttgtaccgt
tggccctctctttcttgctcgggtgctcgataaaacgccgtgccgactccagcagtgatactaccgtcACCCACATCAGCTGACATTGTCGTCATTAGAT
TGCTATGGTGCTGCACACTTGATCGGCCGACCACGCGGGTGCTCTCTAGGTTTTCCAGTTTCAGTCGCCCGTACAACTCAGCAGCCGACGAACCTGTTGA
CTCGGACAATATCGCACCTGTCACAGTCTCTCCAGGCGGAGAAGAGTCATCGTTGCTGCTATCATCTTCCATGACCTTGGGCGGGCGAACAGCAAGACCG
AAATCACCAAGCTTCACTGTTCCTTCGGAGTCCAGGAAAACATTGGGCGGCTTGATGTCGCGATGAATAATTCCTTGGCGGTGGATGTACACGAGCGCTT
CAAGGATTTGGCGAAACATTGTCCAAATCTTATCGGGGTCTTTCCAAAGTGCTCCCTTATCAATCACCTCGCGGAGAGCATTTCCTTCGCAGAATTCCAT
CTGAATGTACAATTTCTCAAACTTCCGCTTCTTTTCGGGTACAGAACTTTTATGACGCAGGGGTTTACGGTGGTAGCCGCTGGCTTCATCATCGCTGGAA
TCATCTTCATCTTCCATCGGCGCTTCCTCTAGCGCCTCCCAGTCAAAACCATCATCCGGATAGCTCTCTGAAGCAAACCTGTGTGAAGAGAGCTGGAACG
AGTGACTATTGCTGCGAAGGCTACGAATCTCGTGTCGAGAAGTTGACCATAGCCCAGTGCTACTGCCCATCGTGCCTAGCCAGTCATCTTCGTCTTCGTC
CGTAGATGTCATCGGTCCCAGCCCATCGTCAACTCCAGACGAAAGACTAGCATCTCCATACAAGTCCTCTTTGCCACTCACTTCATCCCCGCTCAACGAT
CTCTCTTCGTCACTTAAATCGCTGTCCTCAAGGCTCGAGTCCTCTTCGTCATCGCTGGACATTCCACTTTCGCCTTCAATCCACGCCTGGAAGTAGCGCA
CGATATGCCGGTGCTGCATCCGCGAAATAGTCTTCACTTCTCGCAAGATCTTCTTCTTCATGGTCTTGTCGTCCAGGTCCAGCTTGACCTTCTTGACCGC
ATAAAGCTGTCGATCCAGGCGATTCCGCACCTTGACCACCTCGCCTCCTCCTCCACGCCCCAGCAGTCCCAGCTCCTTAAAGTCCCCATGGTATCTCGAG
TGATACCGCTCTGCAGCTGCCACCGCGTCCAAATCCGACGTGTCCGAGTCGGAGTCCGACGGATTGGACGACGTTCCGTCCCGCTTCGAGCTGGCCTCTG
TCTGCTGCTCGTAGATGCTGGACAAGCTCTCCATGTCGTCTCGACTGCCGTCGTCACTGCCGCTGAACTCTCCGTCAATACTCGACCGGTGTCTCCTCCT
TCGCCGCCTGGTCTTCTTCATGGTCTCTCGCTTCTTCCTCTCGGCGTCGATCAGCGCCAGGATCTCCTCGTTCTTGGCCTTGGCCTGCTCCTCCTGCTGC
TGCAGCAGCGCGTCCTCCGCCTGCTTCTCCCTCGTCTCCCTGTCCTGCTGCCGCGTCATCATCTGGTCGAAGAACGACGACTGGTCCTTGAGGTGGTCCT
GGATGAAGTCCGTGGCGAACACCACCAGGTCGTACACGGCGGCGTCGCCCACCTTCTCGCGCGCGAGCTGCTCCAGGCCGCGCTGCAGCCGCTGCGTCTC
CGTGTCCGAGAGCCCGTGCTTGGGCTCCACCGCCACGTTGGGCGGCTGCTTGAGCGGGTACGCGCGCGTCAGGTCGAAGTGCAGCAGCACCTCGGCGGTG
GTGGCCGAGCCGGGCGTGGCCTCGCACAGCAGGCGGATGGCGAAGATGTGCGTGTACAGCGGCGTGGAGCTGTGCGTCTCCAGGTCGCGGTCGTAGATGG
CCTGCAGCACCTCGAGCTCCTGCGCCTGCAGCTCGCGCGCTTCGGCCAGCGTGGCGGCGTCATAGGCGGCGGCGGGCGGCGCGTCCTGCGCGTCTGCGGG
GCAGAGAATCGGGCGGATTTTTAGGTCACCAGATGCGCGAGACGCAGACGCAGCAGCCTACCTCTCTTCTTGGCCTTCTTGCGGCCCATGGACCGA