Description :
From Genome Similarity Track
Location :
Scaffold_723:4133- 5205
Transcript NameFunction/comments
Phyag_g7700hypothetical protein

Sequence
1072 bases(100 bases per row)
tcaaccagcaacagcaatttGGACAATTCGGTGGCATGCAAGGAGGTATGCAAGGAGgtatgcagcagcagcctaTGCAGGGCGGTATGAACATGCAGGG
CGCGGCCCAGGGCCAGAATGCTCAGTCACGATCGAACTCGGGTCCGATGCCTActgagaagaagagcaacgaCGCGTGGGGAGCTGGTTCTTCGCTATTT
GATCTTAATAACCTCGCGAGCTCTACCAgcagtaacagcagcagcgcaggtcgtccaggtcagccgcagcaacagcagcagcagtcaaaTGCAGGTCGCA
ATAGCTTCAGCGGTCTGGATACTCTTGCTGGCATGCCTAGTAAGCCGGCGATgggaggcgctggtggcATGAACCCCATGGGCGCGGGAATGAACTACGG
TGGAGGCATGGGAATGAACCAGGGtggcatgcagcagcaaccttACGGACAAATGCAAATGGGAGCTGGAGGTATGCCTATGGGTGGCATGGGTATGCAG
CAGCCTCGGCCGATGATGGGAGGTATGGGCATGCAACAGCCAGGCATGGGTATGCAGCAACCTGGCATGGGCGGCATGATGAACCAAGGTGGCTTCAGCG
ggatgcaacagcaacagcaacagcagcagcaacagcgacagcagcaggccTTCAGTTCATTCGGCAATTTTAGCTGAAgacgagcgctgcagcctcACTG
CAAAAAGTGAGGCCACAGGTGTCCAGCATGCTGATAATACATGGTGAAAGCGGGAATGGCAAGTTGATGCCTACCGTCCAAACAATTAGACGTAAAGACT
TCAACCGCAACGGAGTTGTCGGTAATGCTTCTGCAGAATGGATGATAGACATGTGCCACATTCCTGGCGGCGTAAATGATCTCAGCATTTGTAGGCCTTG
CCATCTTTTGCATCTAAGGGCCAACCAGACTCATTGAGACCTGCAGTTTACACTGCAACAAGGAAGAACCAATTCCACACATTGATCATTGGCGCTTTGT
GTAGTATCCAAAACGCCTCAATTGACATCCCTCCCTCCGCTGGTGACGCTGATGTTTCACCGCAGAGGTGCT