Description :
From Genome Similarity Track
Location :
Scaffold_97:41329- 43661
Transcript NameFunction/comments
Phyca_LT1534576851Hypothetical protein

Sequence
2332 bases(100 bases per row)
agtgatcgtgaaacggatgacgaggatgacatggagtgtacgcagccgctcgaagaagatgacgatgacgcagatgtgactagaaatgatggcgatggta
gcggtgatgatgaagcggagacggaagtttttccgtattctgggacaggaacgctgccgtatggggttgactcgagttatatggataaaattgaagagga
agagagcaaggatgttgcagaggattcatttagtggagaaaagtcggtcgttgtggatcagaaacgtaaacaacggactagtgaagatgaactcacgagc
ggagagggatctcaagcgacgcagcaggactatttgaccccaagagttaatccttgtcgagtggagcagtttgactctgctgaacagagtgctcaatccg
ttattgctgatgagtctcgtggtaaggagaaagaggattcgggaaaggaggaaagtgacgatgagccagaagattgtgtgcctactcagcccagtaaacc
tcgtacagaagacgaacccgtcgttgagccaaactcgcctcctccgtcaaatgttgccaggaaaaatgtcgtcgttgcatctgattcgcagacgaaagct
attcgcagccttgaattttctttctcgatgccagagtcgcaagatggtgaacctcactttagtgcaagtttgacaagtgagggcactccagcggccaagc
aagttgaagctttctcgagggacaacagactcagtcctttcgaaacttctatcagtccggtgtatcagcctacgccaacgccagtggatgatctagctgt
ccctgatgctgagcctactgttatcgcgaccgaagctcaagtgacgaccaagagaaaaattgtttccccgttgcaatctgggatacccacaggcaataag
aagcaaaaaacttcgtctgaagtttccaattccccggtcaggttgcctccacccccaagaaaagaaagcgtggtgtcttctctcctgagggcagcaggtc
ggtgaaagagtctgatgtttccaatcctcaaacaccacgcccccctgcgcggcgtagcactcgatcagcccagtcaacgccgtcgtcgaccccacaagtt
cgaacacgagctcggaatttgacacccgtgccgttacagcgaatgtacgcgtccagaactcgtgctcaaacgctgttcaagtacaagtttgagttttgct
taacgggttttgtgaaccctggagtagagagtttgaaggagtatattaaagcacatggtggtaaaattccggaacgctacgaggacgtactgtgcaaaag
caactctaaggcggtggtgatcgccacacctgtatcatggaggaagcgcaagtttatgaaagctgttgcgtgtggaatacctgtggtccatactgactgg
attaaacattccgttgacgcgggatatgtgctaccgtttgatgggtaccaagtacctacaggttattctgtcaccacccggaagtctgagtgctttcctc
ctacacaggtaaactttaccaaatggtgttcttagtagaatttacactaacctatcttcgcttgcacatgcaacagctacacatttttgaaggctattca
tttggcatcgccagtgatgtttctcagacaccaaaatcagaagctaaggagaatcgtagtttgataacgtttattttaaaggcttgtggtgcagacgctg
tgtacgaggtgagtccagtttttttagtaacctgctcttgtatcacggtattgacatttatcgtaggatttgtccaataaaactgatgtcagtgtggata
tcgtactatgcgacgagtacacagcagtaagtggcgctgaaaatgtgttgtttgacgttcaattgctaatttccctaatattgttagacatgtcggtact
acaagagaaaacgtcacgtaccggttaaaaacttccagtgggttactgagtgcatgattcttcaggtaagcaactctgaattcattgcttggtacccgaa
ttggtctaaagaacctaaaatgtatttttctgtttagaaaatgttggatccggaagatccagtattcgagccacagcgtgtcggcagtgaagatgtgtct
acagcaatcgctgagatcggtgacagtgacaagtacgcccattgttccgctacttctgttttgaagcagcaactaatttgcttgttggaacactgtagat
ccaccttgaaactctacaccggagaactcgtcatggcagacatttcaggcagtgtagctgaccactgcctcctgtttaacgtctgcgagatcttgagcat
tcacgtgagttcccgcagagacgaagactcgc