Description :
From Genome Similarity Track
Location :
Scaffold_186:41326- 42339
Transcript NameFunction/comments
Hyaar_Emoy2812153hypothetical protein

Sequence
1013 bases(100 bases per row)
CCTCATAGTGGTCTTCAGCTGTAATTGAATAGACATTAACAACATTGAGCAATCACGACCAAGCGTAATTCATATTTATTCTTCTACTGTCTTGTACGGA
CCTGTGTTTGGTCTTTTTATCGTTGGAATTCCTTAACTGATGCTTTGTTTGCTATGTTGATTATCAGAACTATCTGTTGAATATAAGCTGCAGGGATGAG
CCTGCCATCTTACCGTAAGACCACTCCGCTGTGCGGCAATATGACCGACAGGGTAGGACGAGACTCAGATATAAACTCAGGTATAGGAATTGACAAAATG
AAGCCGAAGAAGTGGATGTATACGCAGAGGAAAATGCGGATGATGTTTGGAAGGACTTTAACATGGCAACGGAGACTGGACGGGGACGCAAATGGCGATG
AGGTTTACAACATCAACAACAACAACCTCCAAGATGACGCTGGCGAAAAGGACAATCAAGACAAAAACAAAAACAACGACGACCAGGACCACAAGTACAT
CGAATATGACGAAGAACAGGATGATGCCGGCCAAATGGACCATCAAAACGAAAATAAAAACCACGACGACCACGGATACACGACCATGATCATAATTATT
TCAACTCATTCTCTGTTCCGTTGCATTTGTCATTGTCTGATGTTAGTCGCAGCCGCAGCAGTGGCGACAACAACAAAAGACGCATCACCATCACACGGCG
TGGGAAGCACAGCAAAACCGGGCGTCATACGTCGACCTAGCTGTCGTCTCGCTGCGATGTAGTGTCTTCACAGTGCTCCAATTCGTGGTTTATTTTTGTT
TCGTGCACGTAAGTCTTCACCGTCTTGTTAAGCGGATCGCATAGAGAGGTAGGAACTACTCCAGCCGCATGTTGTCGGGTAATTCACGTTTTCGTCATCG
GCTGTGACGGTGCCGAGATCATGAGGTGCCGCTGTGACGTGGCAATGAGGAACACCAAGACTTTGTCTATAGAATTGGACTGCACTCACACGTCCGCATC
GGACACACAGCTG