Description :
From Genome Similarity Track
Location :
Scaffold_101:41322- 42694
Transcript NameFunction/comments
Phyke_g4001hypothetical protein PHYSODRAFT_495899

Sequence
1372 bases(100 bases per row)
AGATGagctacaacaacaacaaccgaCGAGGAGGCTTCGGGGGTCGCAGTCGCGGACGAGGACGCGGACGTGGCGGATATGGCGGCGGCCGCGGCTTCAA
TAGCTCTGGACTGGGCAGCGAAGTGTGCAGAAACTTCATGAACGGCGGCAAATGCGAGTACGGGCAGAGCGGTCGACCGTGTCGCTACCCGCACTTTGTC
AAGACAATTGGAGAGACTAGGGGCCACAACGGAGCGATCAAGGACGTGGTAATGTGGGAGGAACGTCAGCAGCTGTTCACGTGCTCAGCGGACGCCAGTA
TCAAGCTCTGGGACTGCGCAACGTGGCAGGAGATCACCACCATTAATGTGCAAGAGGCGGTGCCTCCGTCCTCTAGCAACGGCGGGGGCAGAGGGGGAGG
CAATGGAAACAAGAGTCACAATACCGAGGGAGTGATGGCACTCGTGCTCTGTGGCCCCTTCCTCTTTGCAGGCTTTGAAGGACGCTTCCCACCTAATCCA
AAAGTGTCAGTGGGGATGGTCCGTGGCTGGAATCTTGAGAACGCACAGGCCCCACCTTTCGAGTTCTCAGCTTCAGATATGATGCCCTTTGCACACACGA
TGAATGTGCAGTCGTTGACTGTGGCTACGGACCACACAGGCAATGCGACGTTGTTTAGCGGCAGCGCCGATGGATCCATTCGCTACTGGCAGCTGGACAC
CGCGTCCAACCAATTCAAGTGTCGTGGTGTTATGGAGGGACATGTGCGCGGTATTACGAGACTCAAGACATTTACAATGGGCGGTGTACCTATTTTGGCA
TCTTCGTCCGTGGACACGACCATCCGACTCTGGGACCTGACCACATACCAATGCGTCAAGGTGCTATCTGCTGAAGAAAATGGTCACACGGACGCAGTCA
TGGACCTGGAGTTCTGGGTGAACAACAACGAGACGTTCCTCATCAGCGGCGGCTTGGACTCGGAGATTATTGTGTGGAGCTTGACACCACCGTTCCAGCA
GCTGTTCAAAGAATCGCAGGACTCCCAGGTGACGTCGCTCTGTGGAACCCAGgatgctgcacaagcacCAATCCTTCTCATCGGCTGTGCTGTAGGTTTT
ACTAAGCAAGATAGGAGTGTTTTGTTAGAATCGGAAGGCTGACggtgttttgttgttgttgtcgctgctaCAGGATGGGTTGATCACTGTGAAGGAGTTA
CCATCGTTCGCGTATAAGACGACCCTAGGTGCCAGTGTGAATCATGGACATCAAGATGCGGTGCGGCGCATTACCACAGGCCCGAGCAATACCTTCTTCT
CTACTGGCAACGATCGCAAGATGCTGGCTTGGCAGATCACGGGTGATGCTGCCTCAATCCAATCCAAGTAAG