Description :
From Genome Similarity Track
Location :
Scaffold_91:41310- 43455
Sequence
2145 bases(100 bases per row)
CCCCTCCCCCCTTAAACTAGATTCAATCTCTCAAGAGATGTGTAGAAGCGGATGGCGTAATCCATTCGCGAAAAACGTCATGTTCGTCGTCGATGCGTGC
AACGAGTTGTTGATGGCGAATTCCACCATCGTCAAAAACTCGCTCAAAATTATAAAAGAATGGACGTGTCCTCGAAGTATCTTTTCAAGGACACGATTGG
CGCGTTCCGTCTGACCACCTGTTCATGTGGTTAGATGTGAAAACCTTAAGCGCTTTCCGAATGTTTTGAACACGGAACGCCAGGAATCGGCTGTAAATCG
CGGTTCCCGGTAGGACGCGAGTTCTCGAGGCAGCCCATGATGGAAAAAGACCGTGTCGATAAAGAAGATCACAAGCCGATGCGTTGATTGGCTCAGGTAT
AACAACCAATTGTACCATCTTGCTGAATATATGAACTAATCCAAGAGTAGCAGTATTCTTGTGTGGATCTGCAGGGAATCCGAAGACGAAGTCCATTGAA
ACGGATTCCCAGGACTCTACCGGGACGGCCAGAGGCTGCAATGCGACACGAACAGAAGGTCTGGACTCTACTGTTAACAGATCTCAGAGGTCCGAACGTG
TTTGCGCACGAACTGATACTGGCGGGGTCAGTAAAAGTCGCGGCTCACTGTAAGATATGTCCTCTCTCGACCACGATGCCCAACAACGGGTGCGTCGTGG
TACTCATACATGCTACGTAATTGAAGATCGCCATGCTTTGGTCGAAAAAACGTAGCATGCCGCCGACAACATCTGAGTAAAGGAGTAAGCCGTTGCGAAA
CAGTATATCAATCCGTAGAGGATAGATTTACTGTCGACAAATGTTTTAGGCAGATGGCTGCGAGAGATGATGCATCAAACGCACCATTTCCAAATCATAC
GCCTTTCGCTGTCTTCCAGAAAGGTTGACGACGAGATAGTTGAAGTTAAGACTGCTACAGTGGTCCGACAAGTGTCGGGTTGCGCAGCCGGTTCAAAATC
GGGCCGGCGTGAGAGTGCGCCAGCGACGACATTAAGTCATCCTAGACTATACTCGACGGAGAAGTTATACTCCGCGAAGAATGACAGCCACCCTGCCATC
CGCTGCGAGAATTGTGGGCTGTTTACGGCCGTGCTTAGAGACGCATGGTGGTCTGTATAGACGATAAAGGTTATATCGCCCAGTAGGTAGACCTTGATTT
TCGCCAACGCGTTCTTCATGAAAAGCTGTTCCTTGTCATGGACGAGTAGCTACGTTCTGCTGGTTGCAGCTGGTGTGACAGATATTAGACGACACCTTCC
GCACCGTCTGCGTCTACAGCATTTATACTCAGCTGATTGCAAAGTCACTGGCATCATATAACACCTCAAAAGGTCTGTCTTGGTCTGCAATTGCCAAAAC
TGGCAAACGTATTAAGCTCCGCTTGACACATTTGAAGGAGCGCTGACAGTCGGCACTTCATACCCATTTATCGATCTTTGTCAAGAAACGAGAGAGATGA
ACAGTCATCTCGGCGTAATTGTGCGAATATTAGTGCAAATACGCCGCTAGGCCAGGAACGTTTGAAGTCCCTTAACATCTGTAGGCACTGGTTGGTCGGT
GATCGCTTTTATCTTTTCCAGATCGGGCCGGACGCCATGCTTACTCATGATGCAACGAAGAAGTGGTATTTCGCTGGCAGCAAATATACAATTCTTGAGT
ATAACGTACTAATTATGCTCGCGCTTAAGTGCAAGAACTGTCCGGACATGAAGTTGGTGTACTTTCACTTCCGTCTGTACGTCTATAGCCGGGCTGTGGA
CGAACACATCATCAAAGTAGCTGGGCGCGAATGCTTGTACAGATCTCAACAGAATTGCCGCATATCTGTTGGATGTGGCAGGAGCATTACTTAGTCTTTG
TTGCATTACTAAACACTCCCGAAGCATACCGCTTAGGTTGCTAACTGTAGTATAAGGTATGCCTCATTCGCGCATAAGGATCTCATAGAATCCGTTCATC
AGATCTTGTGAAAAAGATAGTTGGTACTCTTTGCCATACCATCGATGGGAACACCATTCCTTGGTATTGGTGTTTCAGCCGGTACAGTTGCAGAGTTAAA
TTTGTTGAAGGCATGCACTATCCGCCATCCTCCCGAGGCTTTCCG