Description :
From Genome Similarity Track
Location :
contig_163:41308- 42611
Transcript NameFunction/comments
g11850.t1reverse transcriptase

Sequence
1303 bases(100 bases per row)
CCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACTGCACGATGGACGCATCGAGCAGATCTGCATCCT
CTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTC
GACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGC
AGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATGCTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATC
GACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGT
GGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTA
CTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCTCTACAGCGGTAAGCACTCGCGAGCGGCATGCTC
TGGGAGTGGCTCGTAATGCCGCAGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAG
CTATTTCGAACGACGTGTTCATCACGCCGGGCTGTGAATGGGAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAA
GCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAG
GAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAA
CTACGCGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGC
TTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAAC
TCG