Description :
From Genome Similarity Track
Location :
scaffold_42:413047- 426578
Transcript NameFunction/comments
Plaha_PHALS_13939IPT domain

Sequence
13531 bases(100 bases per row)
GAAAAATTTCTACTACATTTAATACGAAAACCTCCGTTACGAGCTGGAAAAGAAGAATAATGAGTGAGTACCAAAGATAAATTTCCATATCTTTCTCACG
AATGTTGTACAAAATGGGAAGCATGATTTCTTCACGGAAAAAcatcatgatgagaattaaAACTGGTTGATAAAAGAGTGCCAGTCGCTCCATGGAAGCC
ATCGCAAAAAACTCGATAATTGGCTCCACTGTTTCGGCCTCGCCATTGCCTTCCGCCTTTTTTAAACTTTTGTCGTCGTTTCCCTTCTTATCATTAACTT
TTTCAACAACAAAAGCAGGTGATCGCATTGCAAGCCTGAAAAACAACCTTACGCCACGTCTAGCTCCTTTAACGCTACTCCACATGTATGTTGCGATATC
CTTAACGAAATTCGTGATAGCTTCAATGACAGTATCTGCGTATACCCGCATTAAAATCATCATACCGAAGTCTAGCGCATTTCCTAGAACAAAATCTTTA
AAGTCGGAGGCACCAAACGTCATTATACCTCCAATCAAACTAAGCGCTGAAACTAAAGGCGCCATCAACAACGCTTCCTTCAGCTGCGACTCAATCCATT
TTTCCATGATTGCATTGATGATTTCTTGAGCTACAATCACATAGAACATGTAATCTCCAAACGAACTCCAAAATGAAAATTCGAGCATCAGAACGAGAAA
AAGACCTAGCATTATCGATGCAAAAATCATATTTGCTCGCTTCCACTGAGTCGGCCACCAGATGTTACGCTCCTGAGCATTGCGATCATTTTGTTCAGCT
ATAATCGTTTCGGAGATTGCTAAAGTTTTTGGAAGAAAGATACGTGTACCTAGTATAATGAGATACAGACcaaaaaaaaagaaacatACACCAATGCGTC
CTTTTCGAGATTGTGCCACAACTTCTGGGTTAATCTTGGTATCAAGGTAGTGTTGGGCGATGTTGTCTGTAAGCCAGTAGCCACTTGACATAAAAATCTT
GTTACCGTGCAGCAAGAGGTAGAAGCTACATACAACCGCAAAAATTGGCAGCGAAGCCATAGCTACTCCGACTGTAGGAGGCGGCGCGATCAATGCAAAG
GTAGTCCAAAATCGAAATCGTGGAGGTGATTGTAAATAAGACGTGATACGAACTACAATCCAAAAAGTGAGAGCACCGACTGTCATCATGCTACCAATCA
CAAAGAAGAGGCCAACGAACACTTGTTTGTCAAAGGCAAACTGAACAATGAGCCCAAAGTAGTCGAGCGGATGAAGTTTGATACTGAATGTGTATTCCGT
ATTGGAAGAATCTCGGTCATAATTATCGTAGATAATAGTTGCCATGATAATACGCTTGACGTGAGCATTCATTTGATAGTACGCTACGTCAAGGGTTACC
GATCGTGGAAAACACAGGGTTGAACAATCGCCTTCCAGTGATTGAGCGGCTGAGTTGTCAACAGTCACGGGAACGAAGTAGTCAGAGCCGTGCTGGTCCA
AAATTTCGTCATAATACTGACCACCACGCAAGTAACTTGCCAATGTAGCTGGCTCACGGAGAAAGTAaaaaagtacgcttccttcCGACTGTTCAAACCA
GCGTGGAGTCACATCAGCAGTTGGTAGATCCTCTTCGTAATGACACTGGATATCCATCATGCAGATATCGGCTGTTGGTTCCTTGGCTACGTCTAGTGGA
CCTACGTATCGAATATCGTCCTGGTTCGGCAGTGGTGGAAAAGTGCGTCGCCACCAAGTACGTCCGTAACTTTCTGTCTCGGACGTCATTGCTGGTAGTT
GACATTGGTCACTTTCAAAGAGATCGAAGAGAGGAATGTACGAATCGTACTCCATACAGTTCGATAAAAACGGCACATACGATAACAGTaatttatcaaa
tttgaacAAATATTGCTTACCAGTGGCATCAGTTGGATCACGGTACATCTCTTGAAATGTTTCCCGGTATTTCTCGACTTTATCGTGCGTTACTGCCGCC
GAAACATACGGCATCAACCAATATGACGTATCCGTAACAACGTCCGTGTAAGGATCAGCAACAACTGGAACTCTTTTGCTGCTCACATTGTGGGATAAGA
GGATACGGCCTCGCTCGTAAGCTTCATATTTCGGTGGAAGATTTAGTGGTGGTGACGTGTAGTCTCCGTCTTTGCCGAAGTAAGCAATGAGAAAAGTGTA
GTCTCGAGGTATCATCTGTGATTCATATGAAATAGAGCGTGAAAGAGGCCGCAAATCGGCCGTCACTCCTTGTGTAACATTGCTCCGCGTCGGAGTTTTC
AGCTCAACAATTGTCGAGTTAACGAAGAAGGGTGCTGCTGAAGCGTATAGCCCATACATGACGTGAATTTCCACTTTAAATGTCACATCCTCCAAGGCAA
GCAAGGTTATATTGATGAGATCGTTCTTTTTTACTGTGGTAGATAAAAACCAACGTGGAAGCTCAAGCGGTTGGTGACACGGCGATGTCTCAACATCTGG
AAGCACTACTCCTCGAGGATCGCAAGTTAAGTCTCGGCAGGTACTGTTTCGGACGAAAATTGCAATTTTGTAGTGTTCATCGTAGACAAGATCATCAGGG
AGGTGACGGAAATCAAAGGAAATTTTGGCTTTTCCTAGTCCAGTGAGTGCAAACCACGTCTTATCACTATCACGAAATCCTTCCTCTTTGTCTAATTTTC
TTAGACAATTCGTCATTAATTGCTTCATGTCTAAGGCCGCTACCTTGTTTTCTGACACGAATGTGAAAGCAGCAGTCGTAGTAGAAAAGTGAACTCCATA
GTTGGAGATACTTAACTCCACAGTCTGAGAGAGCACATCTTCTATGGTATTCGTCATGAAAGGAGGAGCCCGACATGTCACTCTTGTGCTGCTTTTGTAA
AACCCTGGTGATGTTTGAGAATATAGAGTCATCGGAATCTGAAATTTGCACACCAGACGTCCCGTGTTTATGAAATTACGGCCAATCACAGTCAAAAGTA
TTCCACCAGCACGAGCCACAATCGGCGGGCAAACGCGAATGGTATCAACGGTATCATTATTCCAGAAGGGTACGGAAGCCGATACATTTACCGGGTTTAT
CACACTAATTGCCTCCACTTCTCCCGTCCGAGTAGTCTCCTTCGTGGAATCAAAGCGTATTTGGCTGCCTTGGAATTGATAAGTAAATTGAGGATAGTAA
TGCCTTTCCGGCAATTTATCACAAATATGCACAGCTCGAATTTTGCaatccaacagctcgtcctCACTTGAGCTTGACCATGTGCCACTCGGACAATTTG
TGTAGACACTGCTACTATTAGCAGTTCCAGAAGGACAAAAGTTGCCATCTGGGCACTTGTCTTTAGTCTTTTCAGTTATCTTGGTCCCGCGAGTGCACAC
GTAACCTTTTTCGCACACGAGTCCATACTGGTTGCTGATAGATGTCGCGGACGAGCAATAGTGCCCGGCAGGGCACATGTGCTCAAACTGCGTTCGCCGA
TTAGTTCCCTCGCCACAAACGTAGCCCTCAGCACAAGGCAAACTTAAAGCCATTGAAATCATACCCGAGTTACCACACACCCGTCCAGCAGGACAAATTT
CGCAGAATGAAACATCAGTCACTCCCGTATTTGGTGACCACGTCCCTTCTGGACAAGCTCGACACGTGATACTGTCGGCCAGTGACCGATAAAAGCCACG
TGGACACAACGACGGAAGATAAGTGCCATATTCTGGACAGCTATGACCAGCAGGGCATACCTCACACTTTACAGTGCCTTTTAAAGGGGTGTAGGTACCA
GGAAAGCACATTGTCGAGACAACGGACCCAGTAGTTCCTGCGAAACTTCCAACTTGGGATTGGATTGGAGTGCTCGTACCGGGTGGACAATAGTGACCAG
CAAAACAAACGTCAGTGCCAGAAAGTGTCGGCGTTCCTTCTTCACAAAAAGTGCCTTCGGTACAAATCTGAGGAGCAACCGCGCCTTCTGGTCGACTTGG
AATCCATTCGATGGTAGTGTTATGTGCCACACCTCCGAGACAGTAAGTACCTCTTGGACATGAATGTGGGTGAAATGGAATCGTATTGGACGGGTCAAGT
GTTCGTGTGCCTTCCATACATATATATCCTGCAGGGCAGAGCAGCGAAGGGACAGCCAAGCCAGCAGAAATACAAACAAATCCAGCAGGGCACAACTTAG
GAGTTGTCATCCTAGGCTGAGGACACACATGTCCAGTCGGACATAGGGAGCAGATAGATTGTTTTGTAAAGGAATTATACGTTCCCGGGTAGCAGGCTCT
TGGTCGAAGATTACCAACTCCCGGGCAATACTGACCAGCAGCGCATacaactgcgtcaaaatCGTTCGGACAATAGTGGCCCGTCGGGCATGGACCCTTG
CCTTCCGGAGTGGAGGAACCACGAGGGCAAAAGAATCCTGCGTAACATTTTTGAGGAGCGCTGTAATTGTTTATTTCCAGCTGCTGGACAGCTACACCCC
GCCGACAATAAGTACCAAGCGGACAAGCATAGGGTCGTTCAGCTAGAAGATCAGTGCTATTTGACACACATAATCGAGAATCGCAGGAGCTAAAACGAGG
CGAATGTTCAATACGACGAGTTCCGATAGCCGGGGCGATCCGAGATATGAGGGCCCACGCTCGTGACGTTTCTACAAAGGTGGCGAGCTGCGTCTCATCA
TCAATCAAGTATTCGGGATTTGTGGAAAAGTCGCGAATATCCGCGGTTTTAGTCCCTTTTCGGCAATAGTGACCCGCAGGGCAAGACTTTAAAGGTGAAC
GCAATCCGTGCTCATCGCATACCATTCCAGCACAACACAGTAAGGGCTTTGTCATTCCGTGGTCGGGGCAAAAGAATCCAACTGGGCAAGGCAAACAAGT
AATTTGGTGATGCCGCGGTTGAAACGTTCCAGGAGTACAAAGGGTGAAGTTAGTTCCACCCGGTGATCCACATGTTGTTCCATTGGGACATGTGTATATA
TCTCCATTGAAGCAAAAGTGAGAGCTTGGACAACTTTGCAAGTAAGTGTACTCAAGGCCACTGGTTGTAAAATCCACCTGATTACTAGTCATTTCCACAG
AAACGGTACCGTTAGTTGGTCGCAAGTCAACAAGTTGTCGGGGTGCAACACAAGTAGCTATATGTTCCGACAAGTACGTTGCTGGGCTTAGTATTTCGCC
AAATCGACAAGCCAACAACGTGTGATTGACAAAATTTGTTCCCTGAAAAAAGACGCTAGTACCGCCTTCTTTTAATCCGTTTGTTGGAAATAATCGTGAC
AGCGATATGTCGCTTACGTacatatatatggcaaagttAGAGAAGTCAATTCCATTATTTGTAACTCGCACTGCCACCTGTCTGGGCGTATCTCGCGGCA
CGGCACAAGTAATCATACCAGGGTCAATATATCTAGCAGAGATCTTTGTCGACCTGAACATGCATGCAAGGTTTATTGAGTTGAAAAATCCCTTGCCGCG
TACGGTAATGACCGTGTTTGCATTAATGCTTGGACCCAGATTAGGAGTTATCGAGTAAAGGACAACTTTCTCGCCGTACTCAAAATATAGTTTTGACGAT
GTAAAATCATGCCCATTGGTACTCAATTGAATTAATTGCTTACCTGGCTGCTTCGAAGCAGGAGTGATACATTCAACAATGTTAGTTGCAAGAACGACTC
CGACCGAATTGATACCGCCAATACGACAAGTGACGACACTTTCATAGCTAATTTCAGGTCTGTGCCATTGAATTAAAAGCTGAGTGCCCCCAGAAAGACT
TCCAATACTTGGTGTGACTGACACTAGATCTGCAGCTGCCGTGTAGGTGAAAAATACTGGATTGGGTGTAAAGGTGACGTTATTGTTCATCACAACAACT
CGCACAACAGATGTCATATCCTGCTGAGGTGGCGTGACACAAACAACTTCAGTGGATGAAACGTACTTTACTACTTGCACTGCGCCAAGTTCGCCAAATT
TGCACCATAAATACAGCCCTCTTCGAAAATTCATACCGTAAATTGTCACTGTAGTTCCGCCAATTTGAGGTCCGTGTGTGGGCGATATATGTTCGACAAA
AGCGTCTGTATAAACAGAGATACCCGTTGGGCTATTCGAGAAGGTTAGACCATCATTTGAAACCTGAAACGTGTATTGCTTAGGTTGTAATCGTGGTGTT
GCGCACACAATTTGTTCGGCAGAGTGAAACCTTGCTTCAACGATTACCGAACCAAATCGACAGGCAAGCTCCAGGGAGTTGATGAAATTATCGCCATACA
CAGTGATTAATGTTCCTCCAATAATCGATACTTCAAAAGGATACATTGACAAGACTGTAGGGATAAGAGAAATGCCGACTTTGTCGTTTGTGAGAGCTAA
TCTACGCCTGGTCGTCTGTTCTGGACTCAGATAAGTGAATAAGATGTCATGAGATGGAATATTAGCTCCATGATCCCAGATATCAAAATTCACGTTTCCA
AAATTATTCTGTCTTGGTGATTTGCACTGCACTAGGTTGGGGCTGAGTACATAAGCCGATGCGTGTACTACACCAAAGCGACAGTGGGACACGGTGTCAA
GTCGGGAACCCTTAATCGACACAAGTGTTCCACCTTCCACTCCACCAGAAAGCGGTTCTACTGTTGCTATAATCGGCGGTTTCACAAGCTCAACAGTAGC
AAAACTTTGAGACTTGAGCTTTCCATCATTTGAAATATACAAATCGTAAAATCCAGGCGTCAAAGCTGGAATTAAACAGTAGACTTTCGATGCTGATTCA
AACTGTGCAAGAGCAATTACGTGGCCGAAAAAACAGCTGAGCGTGGCACTATCGCGAGCATTTTCGGTCACAATTGCAATTTTACCGCCTCCAATCGAGG
ATAGACGCATTGGTGACGCAGATTTGACCtcttctgctgcaagatACACAAAAAAAACAGGACTCGTGGAAAAATCTTGATAATTGTCGGCTACAATGAC
CTGAACACGCTGTGGGGGGCTTTGTGCTGGACTTGTACACTTCATCTGTGTGTCTGATAGTACTTTATGGTAAGTTGCCTGGACAGCACCAAAAAAACAG
GTCGTTATGTTTGCTTTATAGTGTTCACCTTGCAGTGTAATTGTTGTGCCACCCATCCGTGTGCCAACGTTTGGAAATACTTGAAAAATGGTAGGGGAAA
GTTGAAATTCAAATGTTACATCGACCCCACTATTCAAGCAGTCTCGGCCGTTCATACTTATTTTTATTAAAGCAGATTTTGCTTTATGATAAGGTGTaaa
gcactcgagcaccgagGAGTTGATGAGTGTGGCCGGTACCTGATTATCATCAAAGCAACAAGAAAGGTGTGGAGTTAACACGAACTTCCAGCCTGTGACT
GTTATCTTCGTGCCTCCACGGTATGTTCCTGTCGTTGGATGTACCTCATTCAATATGATAGGGTCGTGAACCTCTATAACCAGAGCATGGCTTGACAACT
TCACACCGTATGATATTATATTTACTTCGACAAATCCCCTGTGACTTATTGATGGTGAAATGCATATCAACTTGGTATCGCTAACAACGTTTGCAAAGAC
GCACTTTGATTTCAATCCCGGCACGCTAACGCAACACTGTTGATCTGCATCTCGTCTGAAATTGGCTCCAGAAATTACCAAAGTGCAGCCACCGGCATTA
CTACACAACAACGGTTCCACAGCGTGTAAGCTAACGTTATCATAGTACCAAAGATCTAACTTTTGGAGTTTTGGAGCCGAAATTCCATGAACAAAGAGTG
TAAGCGAAGCTTTTCCAAAGTGATTGCCAGAAGGAGCCAAGCAACTtatttgagcggaagagccAAAAAGAGCAACCGTGTCTTGTATGATCTCGTCGTT
TTGCGAGAACTGACAGATTGTTGtgatatttgaaaaaaaagctcCACTTATTTGAATTGAAAAGCCTCCACGCAATGGTCCGGCACTGGGCGTTAGTGTG
TAGACAAACGGAAGCTGGATGTAAGTAAAGTTTAATTTGGCGGAAGTGAAGTCCTGGCCGTTCAGCGATATCGATAGACTTGTGTCACCAACTTGATAGG
GAGGAGCCTCGCACGATACCGCTGAGTCATTCCAGTATGATGCTGGAGTCCGAAGATTACCGAAACGACATTGTAAACCGGTTGAGTAGCGCAAGTGACG
ACCATATAAGAATATCACAGTGCCACCATAAATATCACCGAAAGCTGGATGCACGTAATCAATTGTAATGTCATAAACGTACTCAAATCGCATATTAAGC
GTGACAAAATTCTGGCCGTTTAAGGCTAAAAGTATTGGAACTTGCTTGGAGCCAACTTCAGCTCCAGAAAGTTTTGCGGGCGGAGTCACGCATTGAATCA
CAGTGGCATTTAACAACAACCCAGAGGTGCAGCTGTATCGATTTCCAAAACAGCATTTTGTTAATCTTGATGAATAAAAGTTGAGGCCTGTAATATGCAT
CAATGTTCCACCAGCTGCTGGACCTGAGACAGGAGAGATGTGGCGGATGCGTGGACCCAGCACATATGTGTATGAAATACTGTTGTGAGTAAAGTCTACA
CCATCATTTAGGGAAACATCGACAAAAACAGATCCAGCAAAGCGACTTAAGGGGGCAGTACACATAAGTTCCTTATCAGATCGTAAATACGCTTGAACAA
TAATATTTCCAAAACGACACAACGGTACACCTGAGTAGTTTCCTGCTCCAGTAATAGTTACCACAGTCGGTGCGTCCATAGAGCCTTGTGTTGGAGATAT
CTTGACGACAATCGGTTGGGAGTAATAGCTGAATGTTTGATTGGTCGAGACGAAATCGCGGCCATTTATCGAGAGATAAATTTCGATTTCTTTTGTATCG
AACGAGGAAGGTGGGCTAGTACATCGAAGTTCTTTGTCACTGATAATGATACCACCAACTGGCTCGGTATTTTCACCAAATCGACACCAGTACCCGTACG
CGCCGCCAAAATGTTTGCCCCTTATCATAACAGGTGTCCCGCCTTCAGCGATACCCGTCGTAGGATAAATCTCTAAGATATCAACTTGAGTTCGAAACTG
GATCATGGATTTTGAGCGAGCGTGTACAAAGTCAACACCATTATTCGCAACCCGGAGTTGAATCCCACCTACAAATGAGGTTGTTGTGGGAGAAAAACAT
TTAATATGCCTCGAAGTGACCCAGATGGCATGAACAGTGAATATCTTTGCTGAAACATTTTCACTAAAGCTACAACCCAGCAGCGGCGAGCGGACAAAGC
CTCGACCGTAAACATCAAACAACGTTTCGATCATTGATAGCGCCTCCAAAGGAACCACTGCCAACACCACTGGCTCTTTGGTGTACGTAAAAGCGTTCGA
CAGACTTCCAGAAAGCCTGCGCGTTAAAGACGATATACTAATGTCAAATTTGCCAATAGTGAAAACTTCGGGAGTCGTACAGATAATTTCGCTGGGCGAA
ATGACCACAGCATTCTGAGAATTGCTATACTCGCCAAATCTGCACACGATCGTTTCTTGCATCACAAACTCACCACCGTAAACGTGTACAGTAGTGCCTC
CTGATATTGCACCAATGTTGGGAGATACACTAACAACATTTAAGTTAACGAGAAACTCAAATGATTGATATGCCGACAAAAAGTCAATTCCATTGAACGA
GATAGAAAGTGATACGCGACGTGAAGTACGCGACTTTGGAATCAAACATTGAAGTTGTGTCCAACTAATAAAAGTCCCGAAAGAAGATAATGAACCGAAT
CGGCAATCGATACGTCTGAACGGTGCAAAGTTTCTTCCGGTAATTAGCACGTGATCGACAGTTTCGTCAGTATCAGATGACGTGTGAACTTTGCTAAATT
TTGGGCTGAAATCGAATATTTCAGGCAATTCGAGCACATCGACCTCAACAGCGTTGGCGGAAGTTTCGACGTCTTTATCGAAAAGCCTCACATAGATTGT
TCCTGGttttaaatatttttctGGAGGTAACGTACAAGATATAACACTTCGAGACACAAGTTCTCCCAATGTAGTCACATTCAAATCGTCAAAAATGCAT
CGCCATTCATGTGACGAGTATGTACCACGACACTCAATCTTGACTTGATCGGTTCGGCCTCTAATGATTGCATCTGGGATGACTCTGATGGGCACTAAAG
GCTTAAACGCAGTAAAACTGAATCCAGTCTCAAAGTATGGTTCTCCACTTATGCTCAATCCGATCGGCAGCTGTTTTGAATTTTGTATATTCCCAAGTGA
ATGAAATTTAACCGCGCATAATAAATGACCATTTGAAACAATTTTCGCCGGAATATTATCAATGATTTCTCCAAATCGGCATTTTGTGACCATCTGAGGG
ATAATTTGGGAGCCGAAAATCTTTATCGAATGGGTTTTGTTGTATATACCACTCGATGGCTCAATTTTTGTAATCAATGGTGTGTTTATGTATAAAAACG
TAGCTTTTGCGTCGTTTACTTCATATGTAACAAGTTTACCTAGTGATACGAAAAATGATACCTCAGTTGCGGCTTTTATCATGGGAGGGCTAACACAAAT
AACGAAAGAGCCATTGACGTAATGAGCAGGCACAGATAACTCCCCGAACCGACATCGAAGCTCATGGTGGTTCAGAAATCCTTTGCCACGAACATAAACT
GACGTTCCCCCACGATTCGAGCCTATTAATGGAGCAGCTTGCGCGACTTCCATTGGACCGACAAACGTAAAATTGACCTTTCTCAGAGTTTGTGTGGCTC
CAAATTCGTCAATTATCACAATTTCAAAGTCGACTAATCCAGCGGAATGCGAAATTGTTTCGCACTCTGCAATCCGAGAGGACATTAATGTGATGATTGT
TCGATGAAGTTTATCAAAAACGCAATTCAAATGAGTCAATGAATTCCAGTTTTCGACTTCGATCCGTATAACCTCGTTCCCGCTGATCGAGCCATACAAA
GGTGCTACCTTAACTATACGTGTCAGGGGCGACAATGTAATCTGCCTCCCTGTGTGAATAAAAGTTTGGTTGTTTACAGACCATAAGAGATCACATCCTG
ATGAGCAAGCATCTGCAGTCGCTCCTGTCTCAAACACTTGGCATGTTCTATTTATAAAGCGTCCAAACATACCCGTATCGATTATATTATTTCCCATCTC
ATTGTCAAATTTTTCAAGTCGGAAGTAATGAGACGAAGAACTTGTTGAAAATTTTCCACACAATTGAATTTGCTGGAATCTATTTCCAAAATTTGGAATC
GTTAAGACCGACAAAATTTCTGGTGCAAGAGTGTAAGTCAAATTGAATATCTCCGCAGCATATTTTCTAGTACCGCTTATTAACGAAACATTGACGCGAG
AAGTACTAGAGAGCGACACTGATGGCGGGACCGAGCACATAATTTTGCCATGTCTCATTGTAGCATTCGACCATTTCGTTCCAAACAAGCAAAGAAAATG
ATCcgcaaaaaataaatttagcCCCGTAATTTCTATTACAGCACCGCCATATACGCTGTCCAGCTGTGGAGTCATACTTAGCAGAATAGGTCGAGACCGA
ACACTAAGTTTGAGGTTAGTAGAAAAGATGTCTTCCCCGTTGAAACTGACGCTGATAAGTACAAGATTTTTGGGTTTGAGATGTGGCAATGAGCAGCGAA
TCTCATCGTCACTAACAAAGTCCAAGAAGTAGTTATTTTCTGTAATTGAATCGTAGCTACAGAACGCAGTACCACCTGAATCGACAAATCCCTTGCCATG
TATTGTCACATATCCGTCAGTATATTCACTGACAACTGCGGGTGTGAGAAAGCGAAACGCGGGCTTTTGCGTGTAGTGAAACATGAACGGCACCAGTACG
ATATCATTAGCATTAAAAAACAAGGCCATGTCGACGACCGAAATCTCCGCGGTAGGCGGTGATGTACACTCTACTTCAGTAGTGCTAGTGACTCGTGCAA
GCACAAAGAATTCACCAAATCGGCAAAAAACATCTGATCGCGCTTGCATAAGAGAGCTAGTATTTCCTTGAAACACAACATTTGTACCGCCTGTGACATC
CCCAGAAGTAGGCTTCATTGTTTCAATGTAAGGTGGAGAGAACACGTCGAACCAGAGTGGAGTGACTGCTTCCCACACTCTGCCTTTTGATCTCACTGCG
AAATTGTGACGACCAGGCTTAGCGAATTGAGGAGAGATACATGCGAGCTCTTGAGCTGATATAAATGCGGCGTGAACTGTTTTAGGCCCAAACACGCACT
CAATATTAGATGAAAATATCATTTTGAATCCGTGCACAACAACTGTAGTGCCACCGCGAGTCCAGCCTAACGTGGGCTCAAGAAAACGTATCGATGGCGT
GGACTCGTATGAACGGGGTTGTTCAGACCTAGATGGATACTGAGTACTGTCATTGACTTCGTTGTTGCCATCGAGATCGGCAGATAGATCCTTTACGTCA
CTCAGTTGAGGCTGTGATACGTACGTAAAGATAAAGACTTCCTCAAAGAAATTCATATTTCCAATTGAGAAGCGAAAAGGGGCTGTCGTGGCTTGAGATG
CCGGGGTTCGACAGCGAAGTGTAGTTGCATCGACAAATGTCGCGATTAAAATTTCATTTAGTACATGGCATCTGAGGTCGATGTCTCTAGAAAATCCTTG
ACCCACAATATTCACAATAGTACCGCCGCTAGTGGTGCCATTATCAGGGTAAATCGAGTGAAATTTGATTCCCGGTTTGAACTCAAAAGGAAATGATATA
TTTGGAAAAATGAGTGACGTCTGTGGAAACAACTGAAAAATTCCAATTGCTGGTATGTGATTGGGTGCTTCACATTTTACCAATGTGTCTGATACATATT
CGGCgattgaaaaataaaaatttgtTCCATTCACACGAAATCCACATTCAAGGCGCATCCAGCGCTGATAATTTTTACCATATATTCTAATGTCCATCGA
GCGGGCTGAAACGGCAAAGGGGGGGTCTACGCTTCCCACTTGAATTGGTAAGTGAGCAATGAATGATTCGCGAAATAATACAAAATCGCGCCCATTTGGT
GAGAATGATACTGAGTACGATCCAACTTCTAATCGTGGCACGTGACAACCTAAAACTTTTGTTTGATCAGTATCGAAACTTTTAAGAGAACTGTAAAATT
CAGTGCCCACATCCATATCCGCTGACACAAATTTACAACTTTTATTTTCATAGCTATTCCAGGACACATTCATCTCTACATAAATTAAATAGTTGCCGAT
TGTCGAGCCAAAATCTGGTTTAAATTTACTTGATTCGAGTATCCTTTCAGCAATGATGAAGGAAGATTGGTATAACACATTTGTAAAATCATCGTGAGTT
TCAAGCACCAACGTTAACAGAACTTGGCCAGCTACCCAATTTCGACGGGTCGAGCATTTTAAACGAGACGGTGAAATGAATGTCGCCTGGACACGCATTG
TCAAAGAGCCGAAAACACAAAAGACGACATC