Description :
From Genome Similarity Track
Location :
Scaffold_61:41301- 49541
Transcript NameFunction/comments
g13888.t1RAW43620.1 hypothetical protein PC110_g161 [Phytophthora cactorum
g13889.t1RAW43619.1 hypothetical protein PC110_g160 [Phytophthora cactorum
g13890.t1XP_008907689.1 hypothetical protein PPTG_13616 [Phytophthora parasitica INRA-310

Sequence
8240 bases(100 bases per row)
TCTGCGCGAACAGAGCCGAGCATTCCATTAGCTCGATCTTCAAAGGACGTAATCGCGCTGATCATGCTGCGCTGGACGTCGCAGCGCCCGCGTCCACGAG
GACGCTGAAGCCTCATTTCTTGCAGCGGGTCGACGGCAGTGCCGCAGACAGCACACACTGCGTGAGGTGGTCGGTCCAACTGCACTGACGAATTCCAGTG
CAACGTGCTTCATGTCGGCCCACTGCTGCGTGCAGCTCGGACAGTGCGTGCGCTGCTGGTGCCCTCGAATCTTCTGCAGCATTTGGTCGCCAGCGGCGCG
AACCATTCGTTCCATCTCGGCTTTGTCCTGTCTCGCCGCGGTAGACTGCGCATAGCTGCTGGTTGCTGTCCGTAGTTGAACAAGACAAGCAGCGAAACGT
TAGTGACCGATATCCAGTGCAAGGCTGCACAGCACAGGAGACGGAATCCGGTGTACCGATGCGTTGCCACTTCTTGAGTTCTGCGACTGCACTGTCCAAG
TCGCGCCGGATATGCTGCATTTGCTGCGTGGTCTGCTCGAGTTGCTGCTGTCGACGCACCAAATCGTTCTGTAGGCGAAACGAACGATTTGAAGTCATGT
GTTGGATTTGGTAGGCACGCTCTAGCTCACATCGCATTTCTCTCAGTCGCTCTGGAATTCGCGAGGCAGTAGTTGTCTGCTGCTCGTTGCGGTTGGAATT
AGGGCGAGTCCGAGGTATGACTTCATGATCAACCACTGCACCTCCAGACGAAAAGTACAGACGCACTATTTTCTTAGCTCCGCGCCGGCAAACAGGACAA
ACTCGTTTGCTTGCTAGAGCTTGTTCCGCACACGTGTGATGAAAAACATGGCCGCAAGCCAATGCTGCCAAGTGTATCTGCAAGCTTTCTAGGCATATAG
CACACTCGGTGGACGCTTGATCTCTTTCTCCGTTCTCGCTCTTGGGCATTGGTGGGGGTGATCTTTGTTGCTCGTACGAAGATGGTGAGCCAGGAAGTCG
ATACGACATGCTTTGTGAATGGGAACTTCTGAGTGGTCTCATTCCTTGCCAGCGCTTCGATGGGAGTAGACGCAAGAATACAGCAACGTAGCTTGCGTCG
TGTCCCTGTTGGGCTTCTTCAACGAACATCTTTCAAATGGCGATACTAGTATTGTACTTTTTTGAGTTCTATGTATACTATCTCTGCGTTCAGGCTGCAG
TAACAGGTCTGCCTAGATATGCAGCATAGCTGCGATGTAGGACGCGCTGGGGCGTAGTGACGGATCGTATTGCAAGCATGCGACTGCCAGCTCTCGGACC
ATCGTGGGACATTCAGGTGTGAACGTGAACATGCCCATAAAACTCGTGTCATCGTTGTTGTGTGCGCCGAGCAGAGGAGTGGTCCGTCGGCGGTTTTCCT
CCAGCCCAACACTGCGCGAGCTTTGCAGCGTACGCGAGCTGTTAGAGCTTGGCAGGCTCTCCAGCTGGGTGGTACGTCGTCGTGAGCTGTCCGAGTCACT
GCCAATGTTAGTTGATACAACCGTGCCGTCCGTAGAGAGGAGAGTGCCGTTGTCCGTGTCGAAGTCACCAATGTGCGTACGCATCCTCCACGAACTTCTG
ATCATTTCGTCTGCTGTCTGGCAAGTGTCCAGGTGTGCAAGCAGCACGCCGAACGCGTACATGTCCGAGGACGACCGAGACGGCTCGCCGATGAGGATTT
CAGGAGCGAAGAACGCCTTCATGGTGGAATCGCAGCTTTGATAGAATGACTGACAACTGTAGGGGGATGATCCATCAGTGGGAAGAGCAGCCTGCACCGG
GTTTAACTTGCAGCCCTTTTTAGGGTCTACAAACACGCTTCGGCCATTGAGCCCGTCGTACGTAACCATGTGCTGGCTGTGCAGGTACATGAGGCCACGC
GCGATCTCGGATGCTGCTTTCATCTTGAAGTTCTTCCAGTTCAGCTCTGAACCAGAACTCCTCAGGTATGCTTCAAGCGTTCCAAGCGTCATGTACTCGC
AAACTGCTGTCATCGCATGTCTTTCGTCCCACACCAGTCCAGTGATCGAAAGCAATTGCGGGTGACGCATTTGCGAGAGTGTTGGCACCATGTCTAAGGC
CGCCTCCACATCGTCATCGCTGGTCTGGAGTTTAGTCACAAGAACCAAACGCGTGCAGTGTTCGGCAAGCGCAACGGTAATAGGGCCCGACATTGACAAC
TGATTCAACATGACGACATCGGTGGACAGGATCTCCTTGAACGCCGCCTTGCGTAGTCCACCACCGGTGTGGAACTCATTAAGTGAAGCCTCAAGCTCAG
TGGTCTGCATAGTGCTATTTGATAGCACACCCATCCGAGATCGAAGGCTCCGCAAATTCGACTTGATCTTGCTATCACCAGATACCAGCGAATCGTGCTG
CTGCAGTGCTGTCTTTTGTTTATACTTTCGCAGGAAAACAACACCCCCGACCACGGCCAACACCACGAAAAGCGCAAGCCCCAGAACGACGAACAGAACA
GCGGAGCTATCTTTGCTCTCGGTTGCAGTGGATGTTGTACTTTCCTCTTCGGAACCGGAGCTGTTGATACTGCCGAGACCGTCACCATTTGTGTAGCACA
CGCTTTTGTCCGCCCAGGATACGGCTTCATAACCAGTGGAACAGCTTCCGGTGACTGTCAAATTGGCTTCAAACACGGGCAGATCCTGCAAATATTGAAG
CTGTGGGTGGGTGACGTGGGCGTCCGTGATAGCGTTGCCTTGTAGATATAAAGCTGACAGGTTGCGCATTTCATAAATAATGGTTGGGATATCCGACAGC
TCGTTGTCACGAAGGTCTCTGTAGAAACAAAGGCTGTCGTTAGTATACCATCCCACATCTCATTATGAAACCGCACGTACAAGGTTGACACAGACGTGAA
CGCATGCTCGCCACGTGGATCAAATTGAGTGAGCTTTGACCGCTGAATAATACTGTGCATGAAACGAGATAAACTCCAGTCAGTTGACGCTGGCTGGGTA
GCCGAATGCGGGTGTGTAAATATCAACATACAGAGACTGAAGACTGTCCGGGAAGACGTTTGTGAGAATTTCATCGATATGAACATCAGAAATGGTTCTG
TAGGAATAACAACACAAAGACTGTCAGTACAAAAGTTCATCCAGATAGCGTATCAATCGCAGCTAAGCACACACATTTGCTGCAGCGCAGTGCCACTCCG
GAAAGCGTCCGACGAAAAAGAGAGCGGGACTGCGATCTGCGAGTTTGTCGTCGCGGTCACGATTGTCCTACAAATTACAACAAGACACCGGAAAATCAAC
GTTAGCAAATACGGCACGCATTCTTTCCAGGGAGCAATCGCCACGTACAAATTCTGCAAGCTCGACGGCAGCTCGAGGTCGTCGATGGCTTGAAACACGG
CCGTGTTGGCCTTGTCGCTTTGTGGCTGGGCGATCGTCAGCGTCCACTGCGGCATGCTCCAGCTTTCTGGCGTGTCCACCAGACACTGCACCTCACACTT
GCCAGACGTGACGTCCGTCTTGCACGTGGGCATGTTGGCATACGCACAGCCCCGGTAGAAAAAGTTTCCGTCATTGTTGTTGTTCTCCTTGCTCCTGTCC
CCAGTTGTCGACGCGTAGTTGACACAGAGCGAAGAGCTGCAGGCTCCGTAGCAGTTGCTCGTGAGCGTGTTGCTCTCCGGAGGGGCACAGGCCTCGTCCG
CTGCAGCGACTGCCACGGCCAGAGCTGCTGCAAACGCTCGGACGCTCCACATTTCTCGCTTGATTCTGCTGGCTTCGCTAGAAAAACACTGGACGCTTGC
TCCCAAGCGAACGCTGCGGCTGCTGAGCCCTCGGACCTGGAATGGGCAAGGCACACACGAGTGTTGCGCGACAGCAACTGGCACGAACTCCACAGGACAA
ATGGTGCTGTGAGTCGCTCCACGGAAATGTCTCACTGAATTGTGCATAGCCAGGAGGTAAAGCCAGTCGGATTTCACCTGTTCAATTGGTCAAAAAGCGG
GTCTGATAATTGTTCTGGTTGGTGGAAAAAGGGAAACCCCGTAACGGCGATTTTGACTTGGGTTTACTATGGCGATCGTTTTTCGCCGTTTTTCGATGGT
GGTCGAAATTCAACGTTCACCTTTCCACCTTTTCTTGCTGGTTGTTCCTGGTGTTGATGGGGACGTCGAGTGCATGCTGGGCGCTGTCTCTAGTTGCTCA
ATTGAAGATGCCGCGATCGATCTTTGAGTAGAGTCGATACTCTTTCGTGCGGTTGAACTCGCAGTCGTTACCACGGGCCTTTCCGAAAGACCTTTCGTGG
CCGCAGGGTGAACACGACCACGCCAAGTAATTGTTGCTGCTGCTCGCCGCAGCGCAGCCTCACTGCAGCAGGCCAAAGTGCGACTGTATGTGCATGTACT
AATACCGATGGCATCTCAGCAATATTGGACACACGATCGGATCGAACGTGAAGTCCATTTACACCTGGCTGTGGTCGTGTGGCTGGGAAGCGAGAGGTGC
GTCTGGGCGGTGCGGCTGTCGTCAGGCCTTTTTGACGAAGTTCGAGCAATCGTGGCCGTGACCATCTCGAAGCTGACCAAATGACCACCGTCATTTCGCT
GATTTGGTCGATAGGCGTGACATGTATCTGTACAATCGCATGCTCGTGGATCGCCCCCAAAGTACATAAAAAAAAAAGCAACCAATACTTCATTCGTACA
CCAACCGAGGCGTGTCCTAATATAGGACGGATTCTACTTCCGGACGGGTTCTATTTTCCAAAACGGTTGTCAACGTGCGTCACCAAGAGCTCAAATTAGA
CGTGCTCCGCTATTTACAACTGCGACAGGTGATCTCCACGCCTGACCGACAGCGACGAGGGGGGAGTGATCAAGCAGTCTGTTCAACGAAGCCGTATTCC
AAACCCCATGAGCGCGCGAAGGTTGCGCGAAGCGACCAAGATTACACCTCGCAGTGCCGTCGGTGCGCCGCTGCCTTGCTATATTGCCACCAAATCCTCA
GTCCATCTGAATAATACATTCTCTTGATGTGCAGGTACCCCGCACAAAGCTGCTGAAACTGAGCACGAGTATTTGCGACGATGTGTGGACCCGGTCCTGA
TGCCCCTTATCGAGTCGTTGCTGCTGTATCAGCCGGAGAGCGTCTTCCACTTCATCCTCGACTTTGTGGACGAGCAGAAGGCCGGTCGCTTTACGCACCA
CCCGCAAAGCGTAGGTTACGCGAAGAAGCTCACAAACCGCCGTAAAATGGTGGATTTCATGTCCACCAGCGTGATCCCCGTCATGGACGATCTAGCCAAA
CAGATTCTCCGCGAGAAGCCAAACTCCGTGAAAGGTGCGTCGTGGCCATTTTTACTACGTACTTGTGTTTGACTTTTAACGCTGACCTGTCCCTCGCGTG
AAGCTTTCATTAAGGACGTGGTTGCTGCGCGTATAGTTATCGAGTCCAGCGAAAGCCCCGAAGAAGCATCAAATCAGCTTGAAGCCCATGTTTACTTCCG
CATAAATGACCGTGTATTATGTCGGTATAAGGGTCGACCACGCTTCTTTCCAGGTATCATCACTGCAACCGATGACAATGGCAGCTTTACAATCTTATAC
GACGACGGAAAGACAGAGAGCAATGTCCACTACATGTGCCTGAGACTGCACCCGACACCGAACTCCAGCGAGACGGCGGCAACACACAAAATGGTTGATG
GAGAAGTTGAGGACAATCAGGAAAAGCCGAAGGCCAGTCGCAAAATGGAGATTGTGCTTTTGATAATTGGTATCGACGGAGCTGGGAAGACTACGCTCCT
TTCCACGTTGCAGGGTGATCTCGACAAGGAGCATGTGCCCAGTGCAGGCTTCACGTCTGCCAAATTTCAGACTGAGACAGGATCTGCTACATTCTACGAC
CTCGGAGGCGGCCCAGCGTTCCGCAACGTCTGGAAAGAATACTACGCTGACGTACGCAACTTGGATGTTGATGTCCTAAATTGATATTAACTGTCACATG
TTGCGTCTTGCCCAGGCTCACGGCATCGTTTTTGTAGTCGACTCGTCAAGCGAAAATTCAGTGCTCCAGGCTGCTAATGTGCTCGAAGAATCGATGGCGA
ACGATCTCATGACCAACAAACCTTTGCTAATGTACGTGCAGCTCTGGGCTCAATGAAAGGCTACGTAATCCCATGCATTAATGAACAACTTGCGTGCATC
ATACAGCTTTGCCAACAAACGCGACCACTCCAACGCCGTAGGAGAGCAGGAGATGCAACGTTTACTGCATCTGAACAAGTTTCCCGGCTCTAAGATTGTA
CCCTGCGTTACCAAGCCAGCCGTCAACGGTGGAGCGGTAGACGAGCGCTTGGAGACCGGTCTTGAGTGGCTCTTTGAACAAGTTCACAATGACTTTGACA
CACTACACGAACGGGTTCAGCGCGATCTAGCACTAAAGAAAAAGCAAGACCAGCAACGGCGAGAGGAGCAACGGGCTCGAGTTTCGCGTTGGAAAGAAGA
GCGTGAACTTAACCAAATGCGTACTTTTGACAAGCCGTCCATAGAGGAGCAAACCCCATCGTCGTCGAAAGCTGCAGCGGATAGACCGGAAGAGTCCGTG
ATATACTGCTCAAACTGCAGTACAGCGCCAGCAGTAACGAAGTGTGCTGCATCTAAGTGGATGCCTGTATGCGAAGACTGTGCAACAGCTTTGAGAAGTC
AGTCCACATAAGGTTGAATCAAGAGATGCTACACCGCAAAAGCAGCGATTTTGGATTTCAAAGGAGCTCTCTATTCTCTATCTCATCCTCTGCGCTTCTT
GCCACCCTTCTTACCGCGACCTCGCTGCCGCTCTTCGTCTTCTTCTTCCTGTTCTTTCTTTGAGCGCGCGCTGTTCATGATCTTCTCTACATTCTCCTTC
TTCTTGCTTTTTCGCATCTCCTTGCGCTCCCGGCGCTTCTCGGCTGCCTTTTGCTCCTTTTCAAGACGCACACGCTCAGCCTCTTCCTTCTTACGAGCGG
CTTCACTATCCGCTTCCTGCTGCTCAGCATCAGCACTATTGTCATCATCTTCCGCAGGTGGCTGAGCAGGAACGTCATTTGCATTGTCAACCTCGCGCTT
CACCTTACCGAGCGCGATAAGCTCCTCCTGCAATACTCGATCCATTTCATCGTCCAAAAGGCTGAGGTCACTAAATACACCAAGTTCCTCCTCTTTCTCG
CGGTGTTTCTTCGACGTGAGGTGGTTCTGCAACTGCTTTGTAGACTTGAAGGTCTTGCTGCACAGGTCACACACAAGAACATCCGCGTCCATTTTCTTTC
GGAGCTTCTCAAGTTCCTGCTCAATGTCTCTGTCGGCAACACGGCTGGTCTCCATACCGCTGTCGGCCCACATCTTCTCCTGCTGCTTCTGAAACGCGCG
TCGCTCGGTGTCATACGCCGCTTGTTTCTCGCGCTTCTTCGCCTCTTCCTCAATACGCCGCTGCTGCTTCTCCTGCTCCTTTTGCTTCTGAAACGCTCGC
ACACGCGGGTCGCGACGGCACACGAAATCCACAAGCTCTCGCACTTCAGTAGTAAATGCCTTCTTGGCCACATCCCGCAGCTTTTTATTCTCCTTCTCCA
TGGCCCGCCTCACCAGTCTCGTGGGTGCATCGGTCGTTTTGTACTCATCCACCCACGCAAAGCTGCGCTGTGTCGTGTAGCTCTTCCAGTGCTGGTAGAA
GTAGTTCACGTCGTCCATCGACGTCTCAGCGCCTCCGATCTTTGGAGCAGCTGCGGATCTGGAGCCGTCACCTCCCTCCACGTCCAGCTCATCAATCTGT
CTCCAGCAGCATAAACTCCCAAATTAGCGTCAAGAACTCGCAAAAATGCTGCACATAATAGCCCAATGCACCTTGGTGAAGAGGTCTCCGTACACGACGT
AGAAGCTCTTTGCGTCCGAGCCAAAGCCCGAATACACCGACGCGCTGAAGTACCGGAACAAGTTGAGCTCGTCCTCGTCTTCGTCCTCATCGTTGCCATC
TCCGCCGCGCAGAATCTGCTCGCGGTGCTCGTCGTACCATTTCTTCTCGTGCGGGTCGCTCAGCACCTCGTACGCGTTCTGGATGGTCTGGAATTGCTCT
GTGGCCTCCTCGCTTGAGATGCCATTCCGCTGGTGCTTGTCCGGGTGCCACCGCAGCGCCTGCAGACGAAACGCCTTCTTGATCTCCACCGCCGACGCAT
CGCGCGCGACCGCCAGCACCTCGTAGTGACAGCGCATTGC