Description :
From Genome Similarity Track
Location :
Scaffold_3:41300- 48670
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.29Microtubule-associated protein EB1
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.95'-AMP-activated protein kinase subunit beta
Pytve_DAOMBR484maker-pve_contig_3-snap-gene-0.79UPF0197 transmembrane protein
Pytve_DAOMBR484maker-pve_contig_3-snap-gene-0.80Dentin sialophosphoprotein
Pytve_DAOMBR484fgenesh_masked-pve_contig_3-abinit-gene-0.160B9 domain-containing protein 1

Sequence
7370 bases(100 bases per row)
ACATGGCCTCGTCCTGCGGCTCCGCCGTGCCCTGACCGCCTTCCGCAGCGGCGTTGGCGGCAGCGAACTCGTCCTCGGTCGCGTACAAAATCTTGAAGAT
GGACTGTGTGAGCGGGCCGGCGTCCGACGGGTCCGCTCCCTCCGCACCCTGCAGCAGGATCTCAATGTCGCGAAGCTTGCCAAAGTAAAAGTCGCGCTCC
TTCTCGAGTCCTTCAACCTATGGCCACAACATGAGCGTCAGTCTCCCATCCCAACCACCAAAGCCGTCTCGCTCGACCGTCGTACCATCAGTCGAAGCTC
GCCATTCTCGTTCGTGAGCGCCTCGTGGCCCGCCTTGACGTCCTCGAGCTCCCGCTCGAGCTCTTCCGTCGCAGCCGTGTCAACTGCCGGGGTTGCAGCG
GCGCTACCCACTGGTCGTCGACCCGCGGCAACTCCCGACTTGGCTCCTCGTGCCGCACCAAGCCCCGTCGGCGCACCTGGAGGCTTCGTGCCGCGGCCGG
CGCCTGTCGTGGAGCTCGGCGCCGACTTTTTGCGAGCCAAGCCAGGCGTGGGCGATGGCGCCGAGCCCGGCCCCGCCGTCGACCCGCCGCCGAGCACAGC
GCCGCCGTGCTTCTGTGTGTACTGCGCGCCGCCCTTGCCCTTCTCGCGCTGCGCGATCGGGTCGTACGGCTGCCCGGACGCGTTGAGCTCGTAGAACTTC
TTGAACCACTGCATGAACTCGAGGTTGTCCTGGTACTTGCCGCGCACGAGGCGGTCGACTTCAATGTACTTGTCGATCTTGAGACCTTGGAAGCACTTCT
GCAGCACCTTGTAGTTCTGGATGTACTCGTAGTCCTTGTTGGCCGACCAGTCGACCTTGGCCATCGGCACCTTGCCCGGGTACATGGAGTCGAGGATCTG
GCACGCCACGGCGCCAGTGCACGTCTGCTCGATCTTGGCGAGGCTCAGGCCGCAGAGGCCGTTGACCCAGTCCAGGATCTCCTTGCGACCCACGAAGTAG
GTGCCGTCCATGAGGCTGATGTTCTGGTCCGCCGCCGCCATCGCGCCTGGATTCCGGTCGCTCGAAGGACAGGAAGGCGAGGAGAAGGCGTCGAGTGAAG
GTCCGCTGCTGCCAAACGCGCGCAAAAAAGGCTTGGCCCGTCGGCGGGCGGTTTTGCTTTCTCGATCCAAAATCCGTGGCGTGAAACGTGACTGTCGCGC
CACCAAGTGAAGTCGATCTTATCCGGATGCGGATGGCGGTCAGTGGGAAAGGTGTTTTATCCGGACTACCTGAAGCAAGCTACTACAGCATGGGGCTCTA
GCCAACGGGTCTGGGTTTGGAGGGATACAGATGCATCAAAACGGGTTCGGATGCGACCCGGGTCAAGACCCGATCGATGAGGTGACTGGAGTGAAAAGCC
AAAGCAAGCATCATGGGCAGGAATGGCGCAGGTGTGGAGCTCGGTGCGCGGCATGTAGCCGCCGAGGGCACTCGATTCTGTGGCAGATGGGAAGGCCTTG
TACTTAACTATGAGCACGGCGATTTATGTGTGCGTTGACAGCCAACGGCGCGCGCGCGAAGCCGGCAAAGGCCAAGAAGGCGGGTCACAACAAACCCAAG
AAGGGAAACATGTTCAAGGCGCTCAAGAAACAGGAGCACCGGTGAGCACACACCGATGCAATATACGCAACTGGTCTGTGAGATTGACGCCTTGCTTGAT
GCATTGCTAGGTCTGGTGTAGTGGACAGCGAGAAACCAGCTCCAGGAGCCAGCAAGTCTGGCACTCGCAGTCGCGTCGTCAAGAAACGCGCCGCGATCCC
GGCCGAGTTCCGCAACTTTGACGAGCGCATGGCTGCCACGAAGAACCGCAAAGCGACAGCCGTGACGAAGACCCCAGTCATCGCTCCACCGACGTTCGTC
GTCTCGGCGCCAACTTTTCAAGTGTACGTTCAACGCGCGCCACACATTGTGTTCTCCGTGACGATGAGACTCATCCGCATGTTGACGATTGTGACGTCGC
CTTGCCTCCATCTGTAGAAATGCTCCGCCACCGCCGACGCAGCCAGAGACGCGAGGGTTCGAGGGATTCTTGTCAGCGATGCAGGTGCGTCACCGTCTCT
GCTTCGTGCACTGTTGTAAGCTCGAAAACGCGCAGTCTAACGCTCCACGTTGTGCGCAGGCACCGCGAGATACCCCAGCGACGCAGGTCGACAGCGCGGC
TCGGAAAGCCAAGTCCGCACCGCCGCAATACCACGCGACGAACGTTTTCTCCGTGCTGCAGAACGAGGACGAGGCTCCGCAAAGCTCGCAGCCCGCCTTC
CTACAGCCGGCGACCTTTTCGTTCTCGACTCCCAGCGCGGCCACGTTCCAGCTCGCGCCGCAGCCGCTGCAGCAACAACAGCCAGTTGGGATCGACATCG
ACCCGGATCTGTAATGCCCTCCATACACCAATGCCACATTCCTTCCATCTGAACCATGGCGTACGTATCGACCATACTCACTTCAAGATCTCCGAGTCCA
GTGGAGTCTGCTAAAGGTGCGCTAACGGTGCGTAAAAGTTGCGCAACTCGCGTTTTCTCTCTCGCGGCGTGCCGTTTTATCGTCGCACACGGCAACGAAA
TCCTGCGCAAGAAGCGGCGGCGGGTTGCGAGCGCTCGAGCGGCTGGCAGCATCCAAGCGACGACGGCACGCCGACCCTGGCGGCGCATAGATAAGCGGGT
CACGGTACAGTGGCAGCAGCACGCGGCGAGCCGGCCGAGAACGCGAGCGTAGAGTTGCGGAGCCGGACGACGCCGGCGGTCGAGCTCGGCAGCGATGGGG
AGCGCGTCGAGCAAGGAGAATGACGCCAACCCGAGCGACCTGGGCACCAACTCTGGCGCGTACCCGATGCACCACCACCCGTACTATAGCCAGGCCACCC
AGGCGTACAGCGCGGGTCTGAGCGGCGACGCGACGGGCGACGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATGGCGCCTTCAA
TCCGAAACCGACGAGCGAAGCCATGGACGTTGACACGCCGCCTTCCGCCGGGGCGGAGTTTGTATTGGACGGCGCCAGCGCCGCGGCCATCGTGGGGGAA
GATCCGGCGAGCACGGCAGCCGGGGACGACGTGGTGCCAATGGTGTTCAAGTGGGAACACGGCGGGCGGAACGTGTTCATCACCGGAACCTTCAACGGCT
GGTCCAAGCAATGTCCGATGCACCGGTCGGGCAACGACTTTACGTACGTGGCGAACCTCACTCGGGGGAAGCACGCGTACAAGTTCGTCGTCGACGACGA
GTGGCGATTCGCTCCGGACCAGCTCACGGTCACGGACGTGGAGGGAAACGTCAACAACTTTGTCGACGTGTCCGAGTTCGCGCCGCTCGCGGACTTTGTG
GCGACCAACCCGAGGGAGGACGACGAGGACACGGAGAACCCGTACTCGAGATACATCCCCGAGATCGACGAGTACACGAAGGAGCCTCCGCCGTTGCCCC
CGCAGCTGCGGCACATAATCCTCAACAAGGTGAGCTCGCTCGCCAATGCGATGTGGTGGCTGGATGCGCGAATCTAATCGCTGTTGTGACGGAGCAGACG
CCACCGAACGTCGACTCGAAGCTGTTGCCTGTGCCGCAGCACGTGGCGCTCAACCACCTGTACTGCACGGCCATCAAGGACGGCATGATGGTGCTGGGCA
TCACGAACCGCTACAAGCAGAAGTTCGTGACGACCGTTTATTATAGCCTCATGCCCGGCGCCAACTGATGCACCGTCGCGCCGAGTCGATGCTGCGTGAG
GCGGCTGCAACTAGAAGAAGCGCCAGCTCAACGGAGACGAGCGGCCGCCAGCTCAGTGCGAGCTTTTTTTTTTATTGTTGTTGTTGAATGAGCAAGCCAG
TCAGATCTGCTATTGGATTCAACAGGAGCAGACCGCGGTGCTCGCACAAACTCTCCATAACGCCACCGTCCACGCATGCGAAATAACGATATATTCCCCT
CGGTCTGGTCCGTCGACCGAGGCCTCTACATCACGTGTTTGCCCGCTCGCCGGTCTGCAAAATCGCCGCCATCTGCAGTGCTCGAGACGCTGAGACCGAT
CATACGTAGATCTCGGCCCAGAGGAAGAGGAAGAGCGAGCCGAAGCCGAGGAAGAAGGCCGCGATGAGCGCCAGCACGAACTCCACCAGCAGGTTCTTCT
TGGGGGCCACGCCGCGCGTGAAGAAGAGCGCAAGGAACGCGAGTCCCGTCAGCAGGAACCCCATCGTCAGCGCGCCGTACGAGTCGGGCGACACCGGGCT
CGTGTACGGGATTTCCTACACACACAGTGCAACGCATAGACGGTTAGATGTCTGCACTGCTCATGCTCAGTGAGTCAGTAGGTCTCCTGGAGGCTCCCGC
ACCATTTCCATCCTTGCCCGTCGACCTTGTTACGTGGCTTGCGAAGATATGCACAGAGCTCCACGTTGCTTGCCCAGAAATAATTGTTCTGTCGTGCACG
GTAGTGTTCACAAATTAGAAACGTTAGACACGAGGAGGGATAGCACTGGAGTTTGGGGTCGACAGAACGCAGTACCGTACGCGACATAAATATAAACGAC
TAGCTGGATTCCTCGCCGATCACAGCTTCAAGGCGCTCCACCAGCTGCGCCTTCAGACCCTTCGTGTCCAGCCCGCGCTTCTTCAGCTCGGCGCGCAGGT
CGGCGACCCGCATCTTGCTCACGTCGATCGCCGGCGAGTGCTTGCTCTCCTTTGGAGTTTGTTGCGGCTCTTCAGGTGCAGCAGAAGTCTCCATGGCGGT
CGCAACAGCTTCGGTCGAGGTATCCTCGTCCTTGCCATTCGCGCTGCTCCGCTCCACACCTTCAGACGTCTCTGACTGTGGCGCAGAACTCTCATCATCC
TTGGCGTCGGTAGATTTCACCTTGGCTTCATCCAGTTGCTTGGTTTCGGCAGGTTCGCCCGCACTCGCCTTGGACGAGACATCTCCATCCGACAAGTGTC
CGTCAGCATTGCCGTCGCCTTCAGCCACAGGCGCACTCGACGGCTCTTCGTCCATGGCGTCCCCATCGCTATCGCTGTGATGCTCGCGCGCCATGATTGG
AGACTTTGTCGAAGTGTCAGCCTCGACATCGTCTTCGCGATTGCTGTGTCCGTCCGACATGGCTTCATCGTCCTCGTCACCGCCGCGCTTGGCACTCGTC
TCGGCTCTTCCCGACGCATCATCACTTCCCTTCGAACCACTTCTGGCGCGACCGCCATCATCCTCATCGCGCTTCGCCTCCTCCAGCTGTTCGCGCAACT
TGTCGAGCTTCGTCTGGAACTCGGCCTCCGTCTCGCGCAATTGCACTTGGTGCTCGCGCGTCGCCGCCTGCATCTTCTCTTCGTGCGCCTCCACAGACGC
CATGACGAGGTCTTCCGTCTCCTTCGTGTGCTTGGCCGGGAGGTAGTAGATCGGCGGCGACGAAATCGTCTGCAAGAACTTGGACAGGCTCGCGCTCTTC
TTGACGCTCTGCAGGTGCTGCAGCTTCTTGCGCGCCAGCGCCTCCTGCATCTCCAGCTCGGTCCGCGCGACCGCCGCCTCCAGCTTCTGCACGGTGGCGT
CGCGCCGAGCCTTGGTCGCGAGCTCCAGGNNNNNNNNNNNNNNNNNNNNNNNTGCTTCTCCTTCTCCTCGGCCTCGTGCTGCTTCGAGTCTTGCCGCTTG
AACAGGTCCGTGTCCTTCTCGATCTGCTTCTTGGCTCGGCCGAGGTGGCCCATCAGCGCGCCGAACATCCGGCGGCTGCGCGCAATGCCCTCCTTCTGCG
TGTACGGCGCCACCGCACGCTTCTTGAGCTGCTCGGCGCGCTCGCCGTCCTCCTGCGGTGCCTCGTCGTCGCTGCCGCCTCCTTCAGGCCTCGCCACCTG
CACATACTCATTGTCAGCACACTGTAACCCAACTGCAAACTGCTTGACATGCAATACACTCACAGCGGAATGCAGACGCTGGCGCTTGGCCGCCCCTTCG
GCGTCCTGACGCTCGCTCCAGCTGCCGCGCTTGCCCAGGCGGCGGCCGCTGTTCCCTCTCGGCGTGTTCTCCTGCTGCGGCGGATCGCGGCGCCTCCCGC
CGAACCGCGGCNNNNNNNNNNNNAGTCATTGCTGCTCCTGCTCGAGCCGCCCAGCCGCGAGAACACGGTCCGCCGACTCGGCTCTCCGTTGCGCGCTGCC
CTCCCACAAAGACTGTCAGTTTGAACGCCCAGTCCGATAGCAGAAGCCCATATCGCAGAGCTGGCCACGCACGCGTCGTGTTGAGCGTCTCGCGCTTCCG
GGCGAGCGCGTCCAGCTCGGCGCGCAACGCCCGCTCGGTCGCCATTTCTTCTCGCGCGCTCGGCTCCCGATCCGATTGGGTTTGGCGGGTCGAGTCCCCC
TGCCAGCGCGTATCACCAACAGCCATGAAAACCCGACGACCCAATTTGTGCAAATGTGTATTGTGAAAAGTCAAGTCTGGATGATTGGGTGTTTCCTCGA
AGCGACGCAGAGCAATTTGATCGACACAACTGCGCACATGGAGAGCTCGGAGACAGAGAGCAAGGATGCGGCAACGCCTGCTGCCTCGACTATCGATAGC
GTGCTGCAGCGACTGAAGCTCGGCGCGGCATCGGCTGCAGCGACGCCGTCATCGGTGGCCCAGTTGCCGTCGTTGCAGCCCGCGGCGCAGCCCTCAGCAG
GGTTCCAAGTCATCTGCTGCGGACAGATCGAGAGCGTCCACGTACGTAGCACTGCGCTTCGGCGATGCGCCGAGTCGAGGTTTGTTTGTGACGAAACGCT
TTGCGCGTGCAGTACCCCGAGATCTCCAATGTCTACTGCCGCTACACCGTCACGTACGGTGCCGACTGGCGAGTGACCCACGTACGTCGACCACATTTTG
ATGAACCCACTGACCCTATCCGAGTCATTGAATGCAAGTTGCATGGCGTGGCAGGGTGCGGAGAACGGGCTCTCGCAAATCGCCTACTGTTCCAACCAGC
ACGACGCCATCCTGCTCAACTTCCCCATCGACGTGTCCTTCAGGAGCACGAACCCATTCGGGTGGCCGCGACTCGTGCTCAGCTTCTACGGCCTCGACGC
GCTCGGCCGCGACGTCGTGCGCGGCTACGGCTCCGTGAGCTTCCCGCTCGGTCCGGGCCGCGTGACCCGCGAAGTGCCGCTCTTCCGACCGTGTTCGTCC
TCCATGCTACAGCAGTTCATCGCGTGGCTCACGGGCTCGCCGCCCGAGTATTTCGACGCCAAGTTCGTCACCGAGAGCGACGGCCGCGAGATCACTCGCG
TCACCTCGGCCGGCAAGGCGGTCGTGCGGCTCAACGTGGCCACCCACGGCATGAAGCAGTTCGGCTTCAC