Description :
From Genome Similarity Track
Location :
Scaffold_485:4129- 5146
Transcript NameFunction/comments
Phypl_g8782glucan 1,3-beta-glucosidase

Sequence
1017 bases(100 bases per row)
TAGTTCGACACGTTCTTCGGGAACGCGCCCTTGCGAACCAGGTCGAGGAAGTTCCAGCGCGAGCCGAACTCCGTCTTGAAATTCCAGAAGTACCAGCCGT
GGCCCACCGCGAAcgcgttcagcttcttcatgttcAGGTTGCGCGTAAATTCAagctcgtcgtggtcgtcctgctggccaaacgacgtgttgctggtgaT
CGGGCACTTACCGAATGACGGACCCGACTGGCCCGTGCCGTACGGGCCTTGAATTGGCTTGGTGGTGTCCAGAGGAGTGCCCGGGAAGCCCTCGCCCAGG
TATGTGCTGTGCGCGGGGCAATTCGTCATGCGACACTGGATGTTGGGGAAGCCTGGCAAGTTGTCGTTGAAGCCGTTCAGCCACATGGCGCAGTTGTCCG
TGCCCAGCGACCACTCGCCGACGATGACAGGCATCATCGcgttctccatctcggcAATCGTGTACTTCTGCTGGCAGGCGTTGGAGAAGTAGTCCGAGCG
CGTGCCGGGGGAGTTCCAGGCCTGGTAGATGTGCGTGTCCAGGGCGATGTCCGGGCAACCGCGCATGAACTGCGACCAGTACTGCACCCCGAAGCGGAAC
GAGTCGTGCAGCACAAACTTCCAGTGCGGTGCACGGGCCTTGACGCGCTTGTACGACTTCCAGTAGTAGTCCTTGAGGAGGTCGATGGGGGTGAGCTCCC
ACGGCTCGTTGACGGGCTCCAGGCCGATGATGGCCGGGTGGTTGGCGTAGCGGTCGACGATGGACGCCACCGTGGCGAGCGAGTGGTTCAGGTGCTCGTA
GTTGATGGACTTGTACGTGTTGGTGGCGGGGTCGAACTCGCCAGCCCACCCGGCCGAGCGCACCGGCCAGTGCTCGAACGTGGTGGTACCGATGGGACGC
GTGCTGGCAATCGATGTCCACTTGACAGAAGAGGACATGCCACTGTTGTCGAAGCCATTTTGCGAGCCGACCAGGCCGTggatgtccagcagcaagtcga
tgTTGTACTGGTAGGCG