Description :
From Genome Similarity Track
Location :
Scaffold_282:41284- 42710
Transcript NameFunction/comments
Phyci_19747Hypothetical protein

Sequence
1426 bases(100 bases per row)
TACTCGATCGAGGACGTGGTGTTGCCGCTACCAGGTCATGCAATTAAGTACCCGACCAACGAAGTGGGCACGGCGTATCGTAAAATGCTGACAACGGATG
GCATCGACCTCAACGCGCACTTTGGACCAGACGGCAGCCAGACCTACCTGCTCGATGGATCATATCGCCACTTGATTAAAAAGCCAACGCGTGTTTCGTT
CCGGTTGGAGCGCTACGAGGACCCGACGAAGCCGTTGATCCCAAATGACGTTGATGCATTGCTTGCGAATTCTCCTGGATCAGCGCAGGACTCTTCTGCC
GGTGAAAATGCCATTGAATCTTCGTCTAGGCCAGCAGTGGAAGGATCACACCGCGCATTAGTGCTCGAGTTTGATCTGGACTACGGTTCCGATGCAACCA
TCGCCACCCGCGAGCTGATGAAGCAAAGCAGCAGCGCGCATGTAAATTGGCAAACTTCAACCTCGGAGGCAGCTGGCAGCGAAGCGTCGAAGAACGCGGA
CAGATCCTCTGCTGCAAATTCTGCTTCAAGGTCCGGTGCGTCGAGCTCACAGGCAATCAAGACTGGCCGTGGCGATACTCGCAAGGTCATCACCGCCCAG
AAGAAGACGCAAGTGGCAATCGGCCGTCCGGGTTTCAGTCTAGGCAGGTCATAGGGGCTGACGGTGTCAGATAGTCTCGTGATGTGTCTAAACGATAGGA
CTCCTGAGTTAGATTTTGAAGATAGTGTGCTTGGCAGTGCGCGCATGCAACTGAAACGGAGACAATAGAAAAACACGCGAGAAAGTTACTTCGAAGATCA
CAGCATGCGTTCCATCCAGACCACACACATATCTATGAATCAACCTTATTAAAAGTTAAAGTCCATGCCGTTGTCACTTCAACGCCATGTAACTTTTAAT
AAGGTCCAATAAAAAGTCCATGCCGTTGTCACTTCTCGTTTGCGGAGAGATCACATTGCAACTTCAGGACGCGACTCGCTTTCGTTCGCGCCACTTATTA
ATTAATAGTGGGTCTGAAATCGGAGCACATCTCAGGATGGAACCAGGCAACTGTCATTTTAAAGTGAGAGAGCACAGTGACACCTAAACCTCGAATTGTT
CAGTCATattccacatagaataacccagtgatgaccttttcgcagtaacatgaggtcacaagtgaattgtagtatttcatagatttgtgacagttgcaca
tcctctCTAGTTGCTTCGAAGCCTACAGATAGATGTAGCATGATCATCCAACATAGTTTCGTATCGGATGAACTCATCGGCAGGAAACTGTCGCTTTCTT
TTCTTCCCATGTGACATAAAATTATTTATGACGACGATGGAAATAAATAATTGAACTTGACGCAAAAGTTGTCAGAATATGTTATTTTGTCAGAAGGCAA
AAAAAAATGCAATACAGTTATTTATT