Description :
From Genome Similarity Track
Location :
Scaffold_105:41271- 42607
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_105-snap-gene-0.36Regulator of chromosome condensation (RCC1)

Sequence
1336 bases(100 bases per row)
CGCAAACCTCACACTCTCGAAATATGCGGCACAAACGGCATTTCTTGCCGAGGACGTCACCATCGTCTCTTCCAAACCGCCGGTAACTCGATTCGTACGC
CTCAAACTGCCTCAAGATGGTCGCGTTGTCGGCGTCCGCCTGAACCGCTCGGAGATAGTAGTCGTCCAGAGCTGTTTGTTGAGGCGAAGGCGGCACGATC
ACAAGTGTTGCGTCATTTCCTGCATGTGCCTCGCCAACTCGACCAACGTAGTTGAATGCGGAATAAACGCCGAACACCTCCACCTCGGCGAGGTGAAGAA
AATTGCGGCCTTCTAGTTGAATGCGCACGTACTGACCGATCGTTtGTGCAGTCGGAAGGAGCCACTCAGTGAGTCGTCGGTTTtCCTCGATCTGTATGAa
CGCTGCAGACTGGTTCTTGGCCGCTCGGAGACCTTCTTTTCCTTGAAGATCACCTCGAAAAGGAAaCTCGCTCAcGAGAATCCAGAATGGAAAGAGCCGT
CCAGAGTATTCGTCGCGCCGCTTGCTGGGGTtgCTTGGTTCATCTGAGCGATTCCAAACTCGGATGCGCTCTATCACGGCCGGTTGTCCTAGATCGACCT
CCCACCATGGCTTGTCTTCAAGCTATGTCACGAAAaTTTGCTCAACACACTATCAGCTTTCATATTGCCATCACAAAAaGATACACACTCACGTGTGTAT
GGCTACACCGCTCCAAGCGCCCGTCGATGTCGCTGTTCACGGCCATCTCAGGGCCTTGCTCGTTGTAGATGTTGATCTGCTTGCATCTTTTCCCGAACGC
CAGATTGTATGGCTCAACATGAAGAGACCGAACAAGCTCTGGGGATGGAATAAACAGTCTATCGATGCTGTGACCTGTGCAGCCTTTTGCGTTTCGCCCC
CATGTGTACAGCTCTCCGTACGCAGAGACTGCAGTTGTGTGCGCAACACCGCAGGAGAGTTGTTTGATGGCCACACTAGCCTGTACCAGTGATTCCACTC
GTATCCACATCGGAGAGTGCTTGCCCAAGGCTGTTGGCCCACCACATGTGTATACATGGCCACCAAGAAGTGTCTTGCTTCCGCCTCGAGACTCTGATGT
AGTTTCCGTGCAGAGGGCCGAGTGAGTTGTCCCGCATGATACTTGCCATACTCGGATTTTGCGGCTCGATAACTCTGTAACCAGCGTCGGAACCACCACT
GTGTCTTGAACGGCAGCTCCGAGGCCAAGCCGACCTCCGTTGGCTGAACCCCACATGAAAAGCTCTCCCTGAGTAGTCACTGCACCTGTGTGTGATGCTC
CACACGACACAAAGCGGATTTTTCGGGTACCTGGGA