Description :
From Genome Similarity Track
Location :
Scaffold_24:41259- 42274
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11261hypothetical protein

Sequence
1015 bases(100 bases per row)
GTCACGTCCAAGTCTCGCACTTTAGCGACACACACACGGCAGAACTTTGTCTGCACAACGTTGAAAGTCTTCTCTGTGCTGTCACTGTCTTCGCCTCCTT
CCCGTGCGCCGCGGTAGATTAAACACTGCCGACAAAAGACCTCACCGCACAGCCGACAGTGCTGACGGCGGCGGGTGTGAGTGAAATCGCGAGAGCACAG
ACGGCACTCGGAGCGCGACTTCTTGTCCACCCAGCAAGTGCGCTTCATGATACCGTGGATTGAAATGAGCTTCGCGTCCACCCAGATGGACATGTCGTTC
ATCTTGGCCATGAGTCTCTTGAAGTAGAACCCGGGGACGGCGAATCCCGCGAAGTCGTTTTGACTCATAAGAAACAATTCCGTCGAATGTGGATCTCCCT
CCGTTGGGCGTACAATGGAGACGATGAGCATCTGCATTCGTTTGGTCTTCATTTTATCAGGTAGAGGCGGGCATTCGGGTAGAGTGAGTGGCATATTCAC
ACGCACTCCGATGTCGCGACCTCGCAAGTCCTTGGTGAAGGTCATGTATTCAAGGAAGCACGTGTCACGCTTCTTGACGAGAGCAAACGGCTGCAGACAC
GTCCATTTGATACCGAGGTACAGATGAGGCTTACCCGACGCACTGGTGTGGATGTTTTTCAAAATGGCGGCGTCAATGGCGTTGCCGTACATGAACTGAT
TCCAAGCGTAGAGCTGGTTTGAGGTCTCCGCATAGAAGAAGTTGATGAAATTGCGGTAGTCCCCACTGAGGCGGCCGAAGATGCGGCATTGGCACCTGGA
AGCGTCACCGTTCTGGCGGACAGTGGTGAGGTCGCCGACTTTGCCCAGCGTCTTCCAGCCGGTCCCGTAGATGGGATTCGAGCCCATGGCCTCGTGCACG
TCGTAGTCGGCCAGCGCGTTCTTCACCGCGAGCGCCATCTTCTCCTCCAGCTCGAGGATCTCGAGTGCAGATAGCTGGACATCCGGGAAGTAGCCGTCGG
GCAGGGGAAACGCGT