Description :
From Genome Similarity Track
Location :
contig_163:41251- 42620
Transcript NameFunction/comments
g14500.t1hypothetical protein

Sequence
1369 bases(100 bases per row)
GAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCC
CAGTCACAAGCTGGAAGCGTTTCGCTCGCGACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAA
GAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCC
CCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGT
GCCGGGAACGAAGTATGCTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGAC
AAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCATCGTTCATGCGTATAACAAGCTGAACGATG
CGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTT
CTATCAGATCCTCATGCGTGAGAGTGATATCCTCTACAGCGGTAAGCACTCGCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGCTGAAGAA
CGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGAACGACGTGTTCATCACGCCGGGCTG
TGAATGGGAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATC
TTCGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCC
TTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGCAAGATTCGCCCGCTGTCGCAGCTCT
TAAAGAAAGGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACC
AAGATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCG