Description :
From Genome Similarity Track
Location :
scaffold_234:4125- 10349
Transcript NameFunction/comments
g1827.t1hypothetical protein

Sequence
6224 bases(100 bases per row)
TCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTGTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGT
CCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCAGACCTCGGGTTTGGTTCCGATG
ACCAACAATTCGCTGGACAATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGTGGGGGCGGGAAGACGCCCCGGGTTTGGTCAACCAAAC
CTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTAGCAGTTCGCTGATCTGCGTCAGGAGCTGAGCTTGTTGAAGGCTCAGCTCGCGGAGGTTG
CGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGGCTCTCTGGCGCCTTGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGTCACCAGAT
GTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCAT
GCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAG
AACTAATGAACCAACTTTGAATTCATTTGTGTTTCCTCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATTTTGGACA
AACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCG
CGTGATGTTCGTTGTCGTTTAAAGTGTCTATGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCTCCAGTCGTCACAGCTGA
TACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATACCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACG
CGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGCCGAGGATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCA
TTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATG
GACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATCCCATGGTGTC
TAAACACCATGTCGACAAACAGACATGTCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGAC
CACTATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCGGACGGAGTCGGTAGTGATTGAAGC
GGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAATAGAAGTCAC
GCGTGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGGTCATCCGG
CACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGAGCACGAAGGTGTTTGGCCAGC
TTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCGCATGATGCGGATGCGGCTTTCACGTCATCCAACAAGGACG
ACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCAGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAA
CCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCCGCAAAGAATGACAGCCATCGTGCCATTCTTTGGGATATGTGCGGCGACTTGATCACCGTACGC
AATGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCAT
GTACCGGGTAATTGCGCTCAGCTGGTTTCAGCTGACGCGATTGGTAGTAAACCACTCGATCACGACCTTCGTGATCGTGTTGCATCAATGCGCATCCGAT
CGCGAAATCGGATGCATCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAT
GTCTGCTGACAATCAGCAGTCCATTCCCATGCAGCTTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACA
AGTACGTGGCGAGTCCAAGGAACTGCCACAGTTCCTTTACGTTTAAAGGCGTAGACCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCC
GTTCTTCCCCGCGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTTGCATAGAGCTTGTGCTTTCGCATGAGCTTAAAC
AACTTGCGGAGATGCTCTATATGCATCTCCACATCCGACCTCCCATTCACAGCCCGGCTGTGACTGAACACGTCATCGAAGTAGCTCGGTGCGAAGTCGC
GCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCATTCCCAGAGCATGCCGCTCGG
AGTGCTTACCGCTGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATC
GAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTG
GTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCGTCGATCGACTTGAC
AGATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTAAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACACCCTTGTACTCAC
GCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGA
GATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATACGTCCATCGTGCAGTTGGCGAGCGAAA
CGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCG
TCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTATATCTGGCAGACACGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCT
TGCGCCGATCACTTCTCGTGCGGAGCCCGGCTCCGCAAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTAC
CCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCAGTGCGGGACGTTTG
CAACCGTCCGCACTGCTTGTAGCGTCAGCTCTGAGAGCCGACGCGCCTTCTTTACCTCTACTCCTAACGGCAGAGTGTCCTTCGACAAATTGTGTGTCGA
CATTACCTGTCGACACTACCGCGTCGCTCCGGACGCTTCGAGACCCTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGGTTCACATCTTCTTCCAAC
GACTCTCGTAGTCGTTGGCGTTCGCTTGGGGTGATCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCT
GCTCCGACAGGTCCATCGCTCTCTGTCGCGCTGCTGCTGCTTCGTCCAGTCGATCCCCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCG
AACTTATCGTCCAGTTCGAGGACGATAAGCTGGTCGACGAACTTTTTCTCTTGATACGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGA
CATCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACTTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGC
TCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGA
CTCTCACTGGGGGCAGCGATCTTCAATGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCATGGCGCCCCGCGCCTGCTGGTCCGTTTAGTT
TTTTGATAGCCCGTGACGATACCCAGTATCGCTACGACGGCTCTTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAG
CGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCA
CCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTGTT
TGGATAGTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATG
TTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGGTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCG
GGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGTACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCG
TCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGACAACGGAGGAGA
GGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGCTCGAGCGGTGGTTTCAC
GCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGA
CAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTA
TGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTGTAATGGGATCTGCTTAGACTCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAG
GAAGCGTAGGTGTATTTAACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGTTAACGGAACCGAACGATAGCTTTGGTGCCAAATGAG
AACCGTATTGATTGTAAATGGGGTTTCCTCCTATAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGAC
TCTCAATGGTAGAAAGATGTTACTTTCTACCAGCCGTATGCTTTTGGCTATGAATGTGGACCACCCTGTAGAGTGGTCAACCTGAATGTATCCCTTAGTG
CATGTTGCACTAAGGTAGGAGGTG