Description :
From Genome Similarity Track
Location :
Scaffold_29:4125- 5798
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_29-snap-gene-0.16U4/U6.U5 tri-snRNP-associated protein
Pytir_DAOMBR486maker-pir_contig_29-snap-gene-0.27Spastin and Fidgetin

Sequence
1673 bases(100 bases per row)
TGGTTTTCATAACTTGATATTCACCATATGTGTGTGTGTTCTTAGGACTGTGTTGAGAAATCCGACTTGGTGGAAAAAGTGATGCAAGTGACTGTCCCTT
CGACCAAGTAAGTGTCGTTCCTGGCGCTATTCCGATCCACTGCCTTGAGCAGGAGCTCTAAACGTTGCTTTGACATCCTTTTGTATGCTTAGGTACAACT
TGATCTCGAACATTGTCCACGACAGCCCCGTGACGACTGGGAAAGAAGCGGCTCTGAAGACAAACCCGTTGACGGAAGGAAGCTACCGCGTCCACGTGCA
GAATAGAGTAAGACCACTTTCACTGGGGTATATTCCTGGTGTCTAACTGCAACAGGTTTCTAACTGCAACATGTGTGGTATTTGTGCTAGGCTACGGAGC
AGTGGTACGAAATCCAGGACCTTCATGTCCAAGAGACGATGCCGCAGCTCATCGGCGTCTCCGAGTCGTACATGATGGTCTACGAGCGAAAGGAATGAGC
ACGTGTTACAAGTTGCGACGCTCTTCCCATGTAGAGATGATGAAAGTTGTTCCCAGAAACGCGCAACAAGAAGAACAAGGTGAATCCTTTTCTTGTCACT
CATACTCCGCCAAATTTGATTTGTGTTTGTTTGTTTGTGCAAAGCTCACTTTCCACCAACACCAGAGACGCCATACAAGTCATTCCATGCGAGCAGCGAC
TTGACAGTTTCTCTCGAGACGCTTGGTCGCACGCGCGTGATCGCGGTTCTAAAGTCGCTCGCGTCGACACCGCGCACGTCCTCGCTTTTCACCTGCGTGA
TGCGCGCGCCGAGCTCTCGGATCGGCCCCATGGCGGCGTCTTTGCAGAGTGCCTTGAGGTCACTGCCAGAGTATCCGTCAGTGGATTTGACGATCGCTAC
CATGTCGCGCGTGGAGATCGATGTTTTCTGTGAGTTCAAGAGATGGCGAAGTAGCGCTTCTCTCGACTCTTCGTCTGGAAGTGGCACTAGAGAATAAAAA
CAAATGCTGTGGGTTGAGATCGCACCACTACCAACTAAAGCCACAAAGAAGAGGAACGTACCGTAAATCCGCTTTTCAAGGCGTCGGATGATCGCTTCGT
CCAGTTCTTGCGGCAAGTTGGTCGCCCCCATGACGAGGATCCGGTCCTCCGGTGACGATGTGGCGCCATCGAGCTCTGTGAAGAACTGTTCCGTTTTAGA
GCAAAGCCAGTCGGTCAAAATCAGGATTGATCATCGAGATGACAAATCCACTGCATAGAGTGTACGCACCTGGTTCTTGATTCGCCTGCTCGCATCGTTC
TCCGAGGCGGACCGCGTGGACAGCAGCGCGTCCATCTCGTCGAGAAAGATCACCGCCGGCTGCAGCTCGCGCGCGATCTCAAAGAGCGTACGCACCAGTT
TCTCGCCTTCGCCGACCCACTTCGAAGTTAAAGTGGACGCCGAAATGCTGCACAACCATCGAGAAAATCAAGACGTTAAACACTTAGCACACATATGCAC
ATACAGTAGTAAGTAGAGAAGGCATCTGTGCATACGCACTTGAAGAACGTCGCGTTCGACTCGGTCGCAACGGCTTTCGCGAGCAGCGTCTTTCCTGCAG
CAGCAACGCCCGAATTGTGAGACTCACGTGCCATGATTCAGATCAACAGAATGGCTTGCAAGTACCTGTTCCA