Description :
From Genome Similarity Track
Location :
Scaffold_540:4124- 6434
Sequence
2310 bases(100 bases per row)
AATTCCAAGGTGATGGTTGATGCCATAACAGGCCATCACTATAACTAAAGCGGTTAATCTTTTCCTTGAGGTGTGACGGAAGATTAACTTTTCGTCCACC
AAAGTGATCTAAAAGCAGACGACAATATTCGTCCTGCATGTAGTTCTCCTTTTTATCAGAGGCCAGAGTGTTTCGAACATGGTCAACCCGTAGGGCTGCC
AGTGTGGACGACTCAATTCGTGCTTTAGTACGAGAAGCGTCTCCAAGGTGTCATTTTTTGAAGTCTGGTCTGCGCGATAATGCGTCAATTAAGACATTCG
ACTTTCCCGGCTTGTATTCAATTCGAAAATTATATTCTGAGAAGAATGTGAGCCACCTCGCCATCCTAGGTGATAGGTGCGGCGAGTTTATCACTGTCCG
CAATGATGCGTGATCCGTGTAAACTACAAAATGTTCGGTGCCCAATAGGTGCACTCGAAACTTAATAAGAGCATACTGTATAGAAAGTAGCTCCTTGTCG
TGCACGGGATAATTCAGCTCCGCAGCCTTTGAAGCCGGGACTGATACGATGTGACACGGTCAATACCATCGTCATCCTTTTGCAAAAGCGCACTGCTGAT
AGCGAAATAATCGCATCGCTTTGCCGCGTCTGGCAAAGCCAAGACCGAAGCCTCTACAAGTGATCGCTTCACTGAAGTGAGAACATCTACTTGAGCCTCG
GACCAAGTCCACTCTGCGTCCTTTTTCAGGAGGTCAGACATTAGTTTGTTCGCTCTGCATAATTGTTGCTATATTTGTGCAAGTAATTAGCAAGCCGAAT
GACTTGACGCAGATCCTTCACATGTCGTGGGACTGGCCATTCCTTAATCGCTTTAACCTTCTCTAGGTCTGCTTTAACACTGTGTTTCCCCACAATGCAT
CCCAGTACAGGTACTTCGGGGACCCCTATGACGCACTTTTGCAAGTTGACGTACAACTGGGCGTCGCCCAGAGTCTGCAACACAACGTCCAAATGACGTT
TGTGTACTTCAATCTCACTCAATCCGTCCTCTTCCCTACTATGAACAAGCACATCGTCAAATTTATGAGGCGCGTAAGCACGGTGTGGTCGAATCACGTG
ATCGACCACCCGGTTGAATGTCGCTGGTGCATTTTCAAACTTTGCGGCATCACTAGCCACTCCCACAGCATACCGCTTGGGGTGCTAACTGCCGTCTTGG
CTACATCGGACTCATTCATGAGTACCTGATAGTAGCCATATTTCAATCTAATGCGGAAAATATAGTTGACTTCCCCATTGTGTTCAATAGGACATCTTTC
CGCGGGACCGGTGTCTGCGCTGGGATGGTGGCCGTGTTAAGTTTATTGTAAGCATGAACTACGCGCTAACCACCTGTTGCCTTACGCAAACAAAAGGTCG
GGCTGCAGTGAGGCGATTTGCTCTCATGTACATGTCCCACCTTGGCTCTCTCGTCGAAGAACTCGTCGATGTAGTCGACCTGCTCCTTAGACAATGGCCA
CTGCCTGGCCACACAATACTTGGTGCCATTTTTAAGTCAATCTCGTGCGGGATACCCTTATCGGCTACTAAGCGGTTCAGCACTTCTGTAGGAAAGACAC
CACGGTGCTTCCACAGAACTTCGTAAAACGGACTGTCCTTCGAGGCATACCAGCCTTGAGCAGCGAATTGTTTTGGTTGGTCGGTCTTCAAGACACTAAC
GCTCATTGTGGACGAGGAGCAACAGTCAACCTAGGTCTCCTTTGGAAATGGCGTGACTATTGTTGTGATTTGAGCGGGAGGCGATAAGAAGAGACGGAGT
GGAGAGACCGAAGAGAACGGAGCGAAGAACACTTGTTCACTTGAGAGAGGATTCGAAAGTGATTAATTTGGTGGAGCTTATTCTACCTACGTCCTGATTT
ATCTGGATCCAGATAAATCAGGTGCGACTGATTTATATCTTGAATCAGATATAAATCATGTGGCATCCAATCAAGCTACTCATCTAATCAACTATGAGGT
AATTACCGTAAGAACTATGTCGTAAGAACTAGACCTTAAAGTTCGGATTGAAACCGGTAACCCTCAACACGCCCCCTCAATCCGAACACGCACGGATTCC
GAGTGCCGTCGTTAAGTCCTTGTGACGCGGTCCGTGAAGTCCCTTGGTCATGATATCCGCCAACATCAGAGTCGTTTCGCAGTACTCGAGCTTGACCTCA
CCGCGCTTGACTTCATCACGGATGTGGTGAATATTGATGTCGATGTGCTTGGCGCCACGTGATGACAGATCTCGTCATCTGATGCACGACTGATGTCTNN
NNNNNNNNNN