Description :
From Genome Similarity Track
Location :
Scaffold_12:41237- 43726
Transcript NameFunction/comments
Physo_156178Os05g0159000

Sequence
2489 bases(100 bases per row)
CTCAAGCGCTTCGGCTGGTGGTTCAAGGCCCGCAGGAGCGAGCTGATAAGGTTTTGCAGCGTTTTGCTTCCAAGATTTTGCTATCGCCGCTGTCTGCAAG
CTCGTCACTGACGAGTTATGTTGTGAGTACGGCGCTATCTACTGATGGGCTCTCCACTCCAGAACAGACCAGGAAACTAGGACGCTTTTGGGCGTCGGTG
GTACAGCATCTGCCCACAAAGAGTGAAGGTGGACAAGAACTTTCGTGGCAGCAGGGAGCTGTCGCCGTGGGGAACGTTGTGGACTTAACGTCCTCGTGTT
CGTTTGACGAAGCTCTCGTACGGGCCATCCCGTCGGCTCTTTCAGAGATGGTGACGTCGTCGTTGGTGCAGTGGGCGTTCGATGTGAAGCACACCCAGGT
AGACCCCATGGCCCTAGAAGAAGACTACGACATGGATGATGATGCTGAAGTACCCATCGTGCCTCCTACGTACCTGTCCGTAGGAAGCGCTGCTTCGGAC
GAAGAAGTTCGCCGCGGTGCACTGGCTCTGGGCGATGCCGAGACTAAAGTGCGCGCGCAGTGGAAGAACCTGTGCCACTCGAGTTTCAGCGCTCGGTGCC
TTGACGTGCTGCTGCATACGAGTGACGCACCCGTGGAACCAACCCCGCCCGGTGGAAATACAGTCTCCCGATTCTGCCGTGTCCTAACCACTGTACTCCT
ATCGACAGGCAGGTCTTACGTGCTCAGCTTGGCTATAAAGTTCGCGAATCCACCTCCAACTCTTTTTGCTCTCCTGAGTGCAATGGCCGTGGATCAGTTC
GCAGGCGGCACTGCCGTCTCTGCTAACAGCTCAAGCTTGATCAACAGCATGTGGCAGTGGATAAAGCCGAGGATCAAGAGTATCGCTGCTGAACACTCTG
CGGGCTCGCTCGCTAATGGTCCTCTGAGATTCACGACGTCGCAGTTACAAGTGCTGCTGGTCTTCAACGTCGTGTACAGCCACATGCTGCTGGGTCTCGA
CGACGAGGCATTCTACGACGGCCAGTGGCCGCTCAGTTTGGCTGAAGTGGAGGCTTTGGTAACGTTTTTGAAGCAGTTTATCTACGATTTATGCTGGACA
ATCACCAGCAACAATACGCTCTCCGTCGACAACATGGACGAGAACGAGCTGGTGCTGTTCTCGGCAGTTGTCTCCTCTGTCAAGTTGTTCAACCAGCTCT
ATGATCGGGATTGCCGACGTCAGTTCATGCCTGGCGGTGCGTGGCTGTGGCCTGCGATGCCTGTCGTCAAGGAGATCGTGGACCTTGAGCTGATGAAGGA
GGGCGGCAACCACGACGCGCACGCGATCTACATGCTGATGAACGGGAAGGCGGCGTCCCCGTACGCCCGCGCCGCGCTGATATTGGTCACGATCCCGCAA
GTTTTGTCGTTCAACGACCGCGTCCAGCTCTTCCAGAAGTTGCTCGAAGACGGGAAGGCTCAGCTGGGAAACATCCGTGACGAGTTCTCGCGAGCTCTGC
AGGTGCGCGTGAAGCGCGACGAGATTGTCGTTGACAGCTTTGATTTCTTCCAGAAAGTGTGCGACACCATGTCCCCCGCGGCCCTCAAGTCCCGCGTCAA
GGTTACGTTCGTTAACGAGCAAGGTCTAGAGGAGGCGGGCATCGACGGTGGAGGCGTGTTCAAGGAGTACATGGACAACCTGACGAAGAACGCCTTCTCG
CCAGAGTACGGCTTCTTCCTGGCCACGGACGAGCAGCTTCTGTACCCGAATCCAGGCGCGCGATACATCGTGGACACGCGGAAGGAGGCGCTCGACCGCT
ACCGCTTCCTGGGGCGCGTGCTGGCCAAGGCTGTGTACGAGAACATCTTGGTGGAGCCGCAGTTCGCGGCGTTCTTCCTCAACAAGTTGCTGGGCAAGTT
CAACTACATCGACGACCTGCACTCGCTGGACCCGGAGCTGTACAAGTCGCTCATGCGCCTCAAGCACTACGACGGCAACGTGGAGGACCTGGCGCTGACC
TTCAGCGTGAGCGAGATGGAGTTCGGCCAAGTGGTGACAAGGAACCTCGTGCCCGATGGCGCCAACGTCCCCGTCACGAACGAAAACCGGATCCGGTACA
TCCACTTGATGGCCAACTACAAGCTGAACGTGCTCTCGTCCATGGAGAGCGCCGCGTTCCTCAAGGGCTTCCGTGACTTGATCCCGGGCACTTGGATTCA
GATGTTCGCGCCCGCCGAGCTGCAGATGCTCATCGGGGGTACAGCCACCAACATCGACATCGACGACTGGGAGCGCCACACGCAGTACGGAGGCGGCTAC
CACCCGTCACAGCCGATCATCCAGTGGTTCTGGGACATCGTGAGGAACGACTTCAAGCCCGAAGACCGCGCGGCGCTGCTCAAGTTCATCACGAGCTGCT
CTCGCCAGCCGCTGCTGGGCTTCTCGCAGTTGTACCCGCAGATCTGCATCCACCAGGTGCGAGTGGAGGACAACGAGCGACTGCCGTCC