Description :
From Genome Similarity Track
Location :
Scaffold_273:41217- 43259
Transcript NameFunction/comments
Hyaar_Emoy2813424GDP-mannose transporter, putative

Sequence
2042 bases(100 bases per row)
ACGTGACGGGCGCCCACTTACGGGCCACGTTGCGGTCGTATGCGTCGTATGACACGATCTTCTGCATCTTGGCGAGCTCTAGCACCAGCACGGCTACAGC
GGCTTGCACAGCCACGACAAAGAACTTCTCGTCGAAGCCATAGTACTTCTTCCCCAGCAAGTACCGGTTCGTGAGCACCATGACGTTGGACATGACACTG
TACACCGTGCACGATAGGATGGAGAGCAGGAGCGAGCCTGCGACGGCACGGTCTTTAGCTGGAGGCATGGCGAGTGGCGGGATAAGAGGGACTAGAGGCG
GGGGATGGAGAAGTGCTATGGGATGATGAGGCTGTCGATTCGAAGCTGGTCAGGGGTCGATCGATGGCCACGCGTCTGATTCGTTTACTGGAGCTTTTGG
CGGGTTAAGAATCCTTTTTATTCATAATGAGTGAGTAATTATTTTTGTTAGATGGGGTAAGAACTACGGTTTTGTTTTAAGTAAAGAGCGACTGTCGGTC
GGTCGGTCAGTCAGTCATGGAGAAGCGAGCAAGTGTTGTTTGGAGCATTAGAGCAACCACAAGGGAAAAAGCGACTTCATTTGTAAGATGAAGTATGAGG
TTACAGCATAGCTTTATTGTGATAGCAGTGGGAAGGTAGCTGTGCTGATATGAGCTCGCGCGAGATAAGTGCTGCGTTGGATATATCCCTCGTGGCGGTC
ACTTTAATTGTAGAATGAAGATACTGCAAACGATCTATCCGGATAGTCAAGAACCAACTTAATTGGTTAAATGCCGTCGATACCAGCACGCACTTGATTA
TTTTGCTTCGCTTTGGCGGAGACATAGCCTGGGGGGCAAGCATGTGAAGATTCCGAGAGCATACATCGATACATAAATGCGTGAAATCCTTGTAATGCAT
TAAGCTTTGTCGTAATTGCGGACAAGATGTTGCATTGCTAGTCGAGTTTCACGACATTTCATAACAGTGGCCTCAGTTCTGTAGCTCACATTTTCCTAAC
GATGGCGTAGGGAACTCAGTAATGAATGCACCAACATGGTGGGGTGGAATCGGTCGATATAAGTGCCTCCAATTAATATCTCTTGCACACCTACTAAAAG
ACGAGTGGATTCGTGGCATATAATACGCGAGTTCACTTTTGTGCTGCTTTTCTTCGCAGTCAGGACTGGCTCCCCATGAATGCAAATTTGCACATGATGG
CATTTCTAGATGTCGATCACTACATTTGTAGACCGGAACGTGGGCATTTCGTCTGGTTTTGGTCTGCTTCGCCTTTATAAATCAAGCTCAGTTAAAAAGC
AGTGAACGTTTTCGGCGCTAGGCACCATTGAGTAAGAAGCTGTGAAGCTAGACTAGAATTGTGACTGCTCACTACCTCGATCTCTATCTATAATATTGCA
TTCACTTTACAACTGCCGTTTATGCTTACGTTTTCACGCTTTCGGCGCAAATCTCACTGCTATAATGAATGACAAATGCCTCGGCGTGTCAAAAATACCT
TCGTTTTTGTGTGCTAAGAATTGGATGGAACGGCTCACATGCTCGTCAACAGCATGATGATCAACCGTAGTTATTTTCCGAATCAACCTTATATCAATAG
TGCTTATCATCCTTCAACGAGCTGAACAACTTTAAGCGGATGCACAAAATGTAACTCCTGCTACTCACCACACTTCGCTGATTGCAGTCAGACTCTACAA
CGCATCTCACTGTGAACGCTAAGGCGAATTAAACCAGCAGATGAGTGAAGTCGGTCTCGTAATGAAGCAAGGTGCACCTTTACGTATTTGTGGATCGGCA
AGCTGACGCTAAAAACATTAAGTGGAGAAGTCAGTAACTCTTACTTCTTACTACGAGCTACACCGACTCCAATCCTTCGATCTTTTTTTATTTTCACCAA
CATATTTTTGCACTACTGGTGCCGACCAAAAGTTACTAACACTTTGATGTTGCTGCTTTTGTTTGCTCGACGATCCCTCCTCACGTAAGCAAACGTCGTC
GAAGTACTCCATAAAAAGCACCTTCAAGCAATTGGCAAGGAC