Description :
From Genome Similarity Track
Location :
Scaffold_155:41207- 42390
Transcript NameFunction/comments
Phymu_g5673conserved hypothetical protein

Sequence
1183 bases(100 bases per row)
CGAAACTGGATGGAGACGCCCagcgtggtgctggacgagaagcgtctgctgcacAACATCGAGCGGATGCAGGCGCTGGCCACGGCGAACCATGTGAATC
TCCGCCCGCACGCCAAGACGCACAAGACCCGGGAGATCGCGACGATGCAActggcagctggagcttgtggccTCACAGTCTCAAAGCCGTCCGAAGCGCT
GCAATTCTTACGTGGTGACGTGCCGGGACTCAAGAGCGTGACGCTGGCGTATCCGGTGGTGCAGATTAACAAGGTGGCGGAGGTCGTCAAGGCGGCACAG
ACGGCTGACGTGGAGTTCTTGCTGACAGTCGACAGCCCCGAAGGAGTGGACGCTGCGCAGAAGGCGGCGGAAGCTTGTGGTTCCACTTTGAAGCTCCTGA
TCCACGTTGATGTGGGATACCATCGCGTGGGTATTGAAGAAAACGACGCGAAGCTACTGCAACTGGCTCAGCGGATTGACAAAACCAGTAGTCTCGAGTT
TTGTGGACTGCTGTCGCATGCAGGTCACGCATACCGCTGCAAGTCGGTAGCTGAATGTtcggaggtggcggagaCGGAGAGGCAAATCGTTGTTCGCATC
AAGTCCACGCTGGAGTCAAACGGAATCGCTGTTCCGGTTGTGTCTGTGGGAAGTACGCTCACGGAAACTGCTCGGGAAAACTTTGAGGGCATTACTGAGA
TTCGTCCCGGCAACTACGTGTTCTTGGATCGCACCCCCGTTCGTATGGGCCTGTTTTCCGTGCAAGATGTGGCGCTGACGGTTCTTGCGACGGTCGTGAG
CTCCAACAATTACAACTTCATCGTTGACGCCGGGTCGAAGGTGCTCAGTTCTGATGGCGCGCGGTCAGCTGGCGACTTTGGCTCTTCGTGCTTTGGCCTC
GCCTTTTACGAGAAGGATTTTGAGCGAGTGGTGAAGGAACCGACGCAAAACAAGTCCGTGCTCGACGACGGTAAGGAGCTCATCTGCTTCGAGGTGACCA
GTCTGTCAGAGGAGCATGGTtgggtgaagaagatcgtgggCATTCCTTCACCTGCCATTGGTGAACGTCTCGTCATCGTCCCAAACCACGCGTGCGTGGT
GTCGAATCTCACGAACAAGTTTTACATTCAGGGCGAGAAGCCAAAGAGCTGGGCTCTCTTGTCTCGCGGATGCACTCAGTGAT