Description :
From Genome Similarity Track
Location :
contig_22:41202- 42260
Transcript NameFunction/comments
g5559.t1hypothetical protein

Sequence
1058 bases(100 bases per row)
AACACCAAGCGCGCGCGCGCGACGGCCATAAAGGCGTTCAATCGCTTCCTCCCCGCCGAAAGCACGAGCATGAAGCATGTCAAGGCTTTGATCGTTGCCG
ACCCAAGCCGCGCGGGGGGCATTCTAGTGACTCTGATGGACAAGTTTGGTGTGTACCTGGCATCCCATGCAGGAGCAAGGGGGCTGCCCTTGTCGCGCCA
TCCCGTCGCTCAATACTTCCGCCAAGCGAAGTGCTGGCTCTTTGTCGAGTACCCTGTTCAAGGTGGAGCTGTGGCCCGGCAGCTGTTCAGCTTGGGGCGT
GCCCTTGAACAGCACTGCATCAAACGCGAGAGTGGTGGGTTCGTCAAGAAAGCGGTTGCATGCACGAAGGATGATCTCAAGAAGATGACAACCTAGCTGT
ATTCAACGACCTGTTGTGCATCGGACTACCAAGATACATCACTGTTGTGTCTCTAGTGGTATCTCTTCGGGCGCGCTTCGGACCTGACCTTCGTCCGGTA
GCAGCAGCTCACCATCGGTGCTGGTGGCGTGTTCTTTATCCGCTTCATCCGCGTGAAGACGTCAGACGAGCAGACGCTGTCGCTCTTTCCCGACGAAGAC
TTCATGACTTGCTCGCTGCTGGCGCTCGCTCTGGCCTTGATCACGCAGGAGTAGCCGTGCGCAGCGCTGCTCAATAACTTGCCATCGCAGACGAAGGACG
TCCCTGTTGAGCTGACCGACTCGATCCCATTGCCGGACCTGCTTGAAGACAGCGGCGCCCTAGATTCTTCTCAGACGTCGAAGAGAAGCACCGCCGTCCA
CACGACACCGACAGTCGGGGTCCACGCTCTTGTCAACCGCTTGCTCGATCGTATTGTTGGCCCAGCTGGCGTCGAAGAGCCGCTGACCTCTCATTCGTTC
CGACGTGGCGGTGCGCAGCATGCGAACGCGAGCTCAGAGTTGACGGCGCAGTGGATATTCGACCGCGGAGCCTGGAACTTGACCACGACTAACAAAGCCT
TCGCATACGTCTTCAATATTCCGAAAGAAGACCATCAAGTAGCCAAGGTGCTGAGCGG