Description :
From Genome Similarity Track
Location :
Scaffold_961:4120- 5355
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_961-snap-gene-0.7Hypoxia-inducible factor 1 alpha inhibitor

Sequence
1235 bases(100 bases per row)
GAAGCCGCACCGGCCAAGAAAGGCCCGGACGTCGTCGCGCAGGATCACGCCCGAGCGCACGTTGCACTGCACGCTCTCGTCCAGTGACACGATGTGGTGG
TACCAAAAGGACGGCACGTAGAGCACGTCACCTGTCTGGACCACTACCTCCGTGGCTGGACAGCTGAGCTCTTGTTCTGACAATGCTGATGTATTGGACC
AGTCGAGCTTCGTGTGGCGCGCCGAGGGACCCGCTGTGAGCAGTCCGAGGCAGGAGCAGACGCTCGGTGGCGACAGGATGTACCGCTTGGCACCGCGCAA
CATGGCGATCATGTTGAGACCGGCGTCAAAGTGGCCCTCAGTGATGATCCCACTCATGCCCAGGCGGCAGCGCAGGCCTCGTGAGAGCGCATCCTGGGCG
TCTCGGATAAAGAGGTCGCCGTAGAGAGACGACGAGCGCGACGGGTCGAGAAACGCCAGGTCCTTGTAGATGAAGGCCGCGCGCGTGCGGATGTCCTGGG
CCTTGAGCATGAGGTAGTAGAACTGGTGGTGCTTGTCGGTGTCGGCTTTGGCTTTGGTGCTCGCGACTGCCTCGAGGAACTGTGAGTACGTCCACCACTT
GGACGCATACGTTGGCGGCTCGCTCTGCGTGGCCTGAGCCTTGGAGTAGTACATAAAGTGGCTGTTGTTGGCGACGTGGACCTTGTAGAGCTCGTCGGGC
TTGAGCTGTTCAGTCAAGTACTGTAATTACAGCCAGCAACGCACGAGTGTGAGTGGTGGGCACGAGTTGCAACTGAGTTAGAGTGCGCATTTAGATACAA
ACCTCGCTTGTCCATCGCTCTGAGGCCTGAGAGAGCGCTGGGATCCCGTAGGAAATGAACGGCACCTCCATTTGATGGAACACCTGAGCTAGCTGGAGCT
CGTACTGTGACAAGCAAACCACACACACACAATGCGTTAGACAAGCATCAGCCAATACCAATAGCTACAGAGCTCGCACGTACTGGTATGGACAGATTAA
ACCTGCAGATGCTCTCAAAGAGCTGTGTTGGTCGCTTGCCAGGCTCCTCGGGCGACCAGTTCACGAGCAAATCACCCATGGGGAAGAGCTGCGGATACGC
TCGGCAGCCCACGCTCGCGTCCAAATCGCACTGGTAGCGCAGCGACGGCAGGTCGCAGCGGTGCAGGCCAGCTATGCCATTAGGGTACGTATGTGGCAGT
GGCCTTGCTACGAGTCGTCCATCCAGCAGCACTGC