Description :
From Genome Similarity Track
Location :
Scaffold_2571:412- 2881
Sequence
2469 bases(100 bases per row)
GTACCGCTTAAGACGTCCACGTAGAGTGTCGGGTGCGTCGTCATTGATTTAGGCATACCGGTGGTGTACGACGCACCATGCCTGGCCAGGACTGCGTCCG
GTCCAATGAAGTGGTGCTTCAGCTTGTTGCGGCCGACAGAGCTGACAGTGGCTAGCGTTAGACCCCTCGTGTCTAATAGCACTAAGCCCCCACCTTAAAT
GCACTTAAGTTATCTCTTCCATGTTTGTCAGAGTACTCCTTCTGTCTGTCTTGAGCTGCTGCCATGGCATTGCGGACCCTGCTGATCACGCTCAGCTTGG
TATCCACAAATTATTCCACTTGTTTCCGCAACGAAACCGGTCTCACGTCGGAGACCTGGGAGGAAAGATCTTTCCGAGCCTCTCCCCAACATAGAATAGA
GGATGCAGTGTCTCCTCGAAGCGAGAGAGCACTCTGTGTGCGAAGCCATTCAGGTAGAATGGCGTGAACCCCGTGGACGCGTCCATCGCGTTGTTGAGCG
CAAACTCAACGACTGGAAGATGCGTCGATCACGTACGTGGTGCGTCCGCGCACACACTGCGCATAGAATCTTCGAGCACTCGATTGACGCGCTCTGTCTG
ACCGTCTGCCTGAGGATCATCCGCAGTGGACATCTGCAGACTCGTTTCTAGTAAAGGGGACAGCCTTTTCCAGAACGTAGCCGTGAACCGCGGGTCTCGG
TCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCAACGATGAACAACCCCGCGGTGTGTTCACCTGTGACGGTAACGGGTACTGGAGCAA
GATGTACCATCTTGCTCAGCCGACACACGAACAACAAAATCCCGGTGTTGCCGTGTCCGTCGGCGGGGAACCGAAAGATGAAGTCAAGACTCATCGACTT
CCAACAGTCAGCCGGAACGGGCAGGATCTGTAGTGGAGCCGAATCGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTCACGTATCGTGCG
ACTCACTTGTACATGTGGGTCCATCAGAAGACCTGAGAGACCGACAAGAAGGTCTTCACGCGACCCAACTGGCCGCTGGAGGGCGCGTCGTGCGCCTCCA
CGAGGAAGTCGAGCGTCCGATCCTCGTTGTTGGGTACGACCACCCGTGGAGGTTCATTGGGCTCCACCCGGTAATAGAGGAGGCCATCCTTCAACTCATA
TCGGTGGAGCCGGGAGCGCTGTCGCGACGAAAGCCAGTCGGACTTCGCGTTCGTTCCTGCTGTGAGGAACTTAACGATAGGCGCGATAGCCTCATCTTCC
CGATACGCCTTGCGTATCCGATCATGTAGATCAGTTGTCACCCGTGTGGTGTGGGCCAACTCGTAGTCTGGACGCCGAGAGAGGGCGTCCGCAAGCACGC
TGAGCTTGCCCGGCTTGTACTCAACGCGGAAGTTGTACTCCGCGAAAAGGGCAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCAAATTTGTCGCCGTC
CTCAAGGATGCGTGGTCTGTGTAGATCACGAAGGGCCGTGAGCCCAGAAAATGAAACCTGAAACTTCACAAAGGCGTACTTCATTCCCAGAAGTTATTTG
TCGTGAACAGGGTAGTTCTGTTCGACGGCTTTGGGCTGCCTGGACTGGAATGAGATGGCTCGTTCATGTCCAGCCGTGTCGGCCTGCAGCAGTGCACACC
CGATGGCATAATCGTAGACATATATGGCTCGTTCATGCCAACCGTGTCGGCCTGCAGCAGTGCACACCCGATGGCATAATCGGAGACATCGCAGACGACG
CTTATCGCCTTAGTCTCGTCTCGTCAGGCAGGGCCAGGACAGGGGCGTCTTGGAGAGTGGCCTTGATGCTGTCAAAAGCATCATCGTGCTCTTGCTCCTA
GCGCCAGTCGGCCCCCTTCTGAAGGAGGCCCGACAATGGCTTAGCAAAGCCCGCGTACTGTGCGTTGTACGTTTAAAAGTAGTTGGCCAAGCCCTCCACT
TTCGAAGATCCTTCTGGGATCAAGGCGTAGGCCATGCTACTATGGCCTTGACCTTGTCTGGGTCAGCCCAAACGCCCACGCTGCTTACGAAGCAATCGAT
AACCTTAATATCTGGTTACGCGAAGACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAGCACTCGACGGAGGTGCCCCAGATGC
ACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACAACGATGTCGTTGAAGTACATCTGTACGAAGGCGCGCATTGGGATAAACAATTGCGTCA
CCAGACGGTTGAATGTCGCCGGAGACAAGCCCAGCAGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTCACCGTGGTGAGCGGGATGTCGCT
CTCGCGCATCAGGATCTCGTAGTATCCGTCTACCAAATCCAGCGCACTGTACATTCCGCTTCCGGCCAT