Description :
From Genome Similarity Track
Location :
Scaffold_1967:4119- 5815
Transcript NameFunction/comments
Phyta_totarag13939PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1696 bases(100 bases per row)
CttgacttcgaggaggtgcaaacacctcgaagcatattggaagtacgactggcAGCAGGTGCCGTCGTGAAAAAAAGAGAAGCGTGTCGTACGCGTACGC
TTCTCGTACCAACAAAATAAATTTGTTGAAGATCTTATCGTCTTCGATTTAGACGCAAGTTTGCCTTAGTGCTGGGCATGCTGTGGCTTGTACGGCATGA
CCCAAAGatggactggaagaagcgtaCGATTGGACGCTTCGGTTGCAACAGCGCAACAGTGAGCGATGGCCCTGTCAGCACAACATATGCATCGCGAGAT
GCATTCGACCATCCACTAGAGACAGCCGCGTTTACGCGCAGAGCGCGAATGAGCAAAGCTCCGACGACTTCGGAAGTCGTTGGAAGTGAATGTGTGTCGG
TTCTAGGAAGCGACACTGAGAATCTGATAAACTCGGATTTAAAGGATGATCCCGCCACAAAGGACGAGTCAGCTCTGGGAGCTGACGTGAATCTGTTGGA
TCCAATTCGACAGAAATCTCCGCCGAAATgcgtcgaggcgacgaaggcgcgtcAGCTCCGGGTGTTAGCGCTGCGAGTAGTGCGGATGGTTGCAAACGTC
CAGCACAAGACAAGCTTCAAGATCACGTGCAGcagagctgcacgaagaagcgaatGCTCATCAAGCCGGGCATGATGACGCGCGACCGCGGATAGAATCT
GCCGGTGACAACAACGGTAAACCCGCCCACGGCTGGGCCTGGACGAGGAACACGCGGAGCCGGGCTCCgaaagaggaagaaacgaCAGCACAGtcggaag
aagctgcgcgaggcTCGGTCCGGGACCAAGATGATAAACAAGATGTCTGCCGGGCAGACATCAAGTCCGTCGTCGAGTGTCGAGACGTTGAATGTCTTGA
CGCAGACCGGTACTGGGCTTCAGTACAGGTATGATACTTGAGAATCCTCCGACGAGTGCGTCGGAGTTGACATCGCTTCCAGtcatgagctggaagcact
TCACGCGTACTTGCACAATGGACGCATCGAGCAGATTTGCATCGTTTCGGACAGGGAAAGGTTGAAGTGTGAGGCGAAAGAGTTGAAGCAACTATTCGCT
GGTAGTATCGCTGAGAGTGTCCTCACTCTCAGCGCAGAGCAGAATTGGAACTCGCTCAAGGCGAGCCTCTATTACGACGTTCTGCGATAGTATAGCGACG
TACTCCCGGACGATGTCCCTACGGAGCTCCCGCAGGACAAGATAATTCCGCACGATATCGACCTCGTGTCGGGCACCAAAAGACTGTGTCACAAGTAAAG
GCGATCGACGACTACTTTGAGAGTCGTCGTAAGGCAGGTCAAGTGCGGGAATCAAAGTCCCCGCACAGTGCACCGACGTTCCGTGTTAAGAAATCATAGG
GCGGCTGGTGCATCGTTCATGCGtacaacaagctgaacgatACGATGATACCGGCACAGACGCCGATACCGCGGAAAGATGTGATCATCGATTCGATGGG
CCTGAGCACAATCTATGGTGCTCTGGATATGAGAGACGGGTTCTATCAGATCTTAATGCGCGAGAGCGACATCCCTATCACGGCGGTAAGCATCCCAAGC
GGTATGCTTTAGGAGTGGCTCGTCATGCCAAAGGGGTTAAAGAACGCCCCTGCGACTTCGCAACGagctacttcgacgacgtgttcgtTCACAGCC