Description :
From Genome Similarity Track
Location :
Scaffold_103:4119- 5650
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_103-snap-gene-0.28Mitochondrial ribosomal protein S22

Sequence
1531 bases(100 bases per row)
TCCTTCTTGTAGATGGAGGCGTCGGCGGGCCAGGACGCCCCCCAGTGCGCCTTGCGGGCGGCGCGGTAGACTTCGCGGATGGATTTGCCCCTCGTGACGC
TGCGGCGCTCGATTTCGCCCTGTCGAGATAAAGTAATCGGCATGAGTACGCTTGCTGCCATCATAATAGTCTTAACCAATGCTAGGGAATACCTCGGGCG
TGCACAAGTCGAGGTGGACGTGTCTTGTAGCGAGCAGCGGACTCCTATCAACACAAATTAGTCATCAATGTTAGAGTTAATCATGCCAGTCATGCGATAG
TTATTGATGATCCCACCTCACGAGCCGCGCGAGTTTGCTCTTCTCCTGCTGCTGAGCGCCGGAGGTCTTTTGCAGCACGACGTAGCTGAACTTGACGCCC
TTCTGCCCGTGCCAGCGCTTGGCCGTCGCCACGCGCGGCAGCTGCACCTTTGGCGCACGCTGCACGAAATGGCACCACGTGCTGCCTCCCATCGGACACT
GCCATCCACAGCACATCGTTGAAAGGTTAGAGTCATCCAGTCATCCATTGACACAATCAGAGAATGGACGCACCTCGTGCTGGTGCGGACACGGCGCAAC
GACCCGCACACCCTCACGCCCCTTGTTGTTATCTTCGTCGTCGTCCTCCTCATCATCATCATCTGCGACCATGTCGAGCACGAACTGGCGAGCCGAGCGA
ACCTGGTGCGACCCCCATGGACTGCCGCTGTCCACGAGCACGAGGCAGCCGCCGTCCGCCAGCAGCTCCCAGAGCGCCGATGTGACGGCCACGCGCTCAA
AGTCGCTCGGCAGCTCGGCCAGCACGTGGCTGGCCACGATCAGGTCGTAGCCGCCGGTAGACGCGCTCAGCTCGCGCGTGAGGTCCGCCACGCTGCGACG
CACGCTGAGTCCCGGGAAGCCGTCGAGCAGCGACAGCGCCGCGTCCACCATCGACTGGCTCGGCTCCACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCGCCGAAGATCTCCTTGGACACCCACGAGGCCGTCCCGGGGCCAGCGCCAAAGTCCAACAGCGTCGTCGGCGCGAACTTGGGCAGGCGGCGCTT
GAGTTCGCTCAGCACATTGTGTGTGCTTGCATAAGTGTCCTCGACCTCGTAGGCCAGGTACGCGAGCGTCTCGGCCGGCCCGAACGCGTAGGGCGAGATC
TGCGGCGTCTTGTCGAGCGTCCAGCCCACCGGCCGCGAGTGCATGTCGATCGGCGCGCCGCGCGCCGTGTGGCTGGTCAATGCTCGATGCTTCTCGCGCA
GAGTCTCGAGCTGCGAGTGCGACCGCGCGCGCACGAGCGTCGTGAGCCGCTCCAGCAGCTCCACAGGCATTTCGATGCGGTACGCCAGCGAGTTGCTCGA
CAGCTCGTCGATCGAGGCGACGAGCGAGACCGAGTCGCGGAACGACGTGGACGAAGGGGATGAAGACTTGGCGGCCTTGGCGGCTTGAGCGCGGCGAAGA
CGACGCGCGCGAGGACTGCGGCTCGAGGGGA