Description :
From Genome Similarity Track
Location :
Scaffold_674:4119- 5180
Transcript NameFunction/comments
Phyke_g10682ATP-dependent RNA helicase eIF4A, putative

Sequence
1061 bases(100 bases per row)
ATCGAGACCTTCGATGGCATGGAGCTGCGTGAGGACCTTCTCCGCGGTATCTACGCCTACGGTTTCGAGAAGCCTTCtgccatccagcagcgtgccGTCA
AGCCCATCCTTTTGGGCCACGACTGTATTGCTCAGGCTCAATCTGGTACCGGTAAAACCGCCACGTTCGCGGTTTCCATCCTGCAGAAAATCGACATTAA
CCTCAAGGAGACTCAGGCTCTGATTCTCGCTCCGACCCGTGAATTGGCCCAGCAGATTGTCAAGGTGGTGGTCGCCATTGGCGACTACATGAGCGTGCAG
GTGCACGCCTGTGTGGGTGGTACCGCTGTCCGTGACGACATCCGTACGTTGCAGCAAGGTGTGCACATTGTGGTGGGAACTCCTGGCCGTGTCGGTGACA
TGATCAACCGTCGTGCTCTGCGTACCGACGAGGTCAAGatgttcgtgctggatgaggctgATGAGATGCTTTCTCGCGGTTTCAAGGACCAGATCTATGA
AGTTTTCCGGTTCCTCCCGGAGAAGGTTCAGGTCGCTCTGTTCTCGGCTACCATGCCGCTGGATGTGCTTGAAGTGACGCACCGCTTCATGCGCGAACCG
ATCCGTATTCTTGTGAAGCGCGACGAACTGACCCTAGAAGGTATCAAGCAGTTCTTCATCGCTATTGACCGCGAGGAGTGGAAGTTCGACACGCTCTGCG
ATCTGTACGAGACGCTGACCATCACACAGGCCATCATTTACTGTAACACCCGCCGAAAAGTGGACTGGCTCACGGAGAAGATGCAGTCGAAGGATTTCAC
CGTATCGGCCATGCACGGAGACATGGAGCAGCGCGAGCGTGACATCATTATGCGGGAGTTCCGTTCGGGTTCGTCCCGTGTACTGATCACCACGGACCTG
CTGGCTCGTGGTATTGATGTGCAGCAGGTGTCGCTGGTCATCAACTACGACCTGCCCACGAACCGTGAGAACTACATTCACCGTATCGGTCGTTCGGGCC
GTTTCGGTCGTAAGGGTGTGGCCATCAACTTTTTGACGCACAACGACGTGCGATACCTGCG