Description :
From Genome Similarity Track
Location :
contig_22:41183- 42239
Transcript NameFunction/comments
g4705.t1hypothetical protein

Sequence
1056 bases(100 bases per row)
AACACCAAGCGCGCGCGCGCGACGGCCATAAAGGCGTTCAATCGCTTCCTCCCCGCCGAAAGCACGAGCATGAAGCATGTCAAGGCTTTGATCGTTGCCG
ACCCAAGCCGCGCGGGGGGCATTCTAGTGACTCTGATGGACAAGTTTGGTGTGTACCTGGCATCCCATGCAGGAGCAAGGGGCTGCCCTTGTCGCGCCAT
CCCGTCGCTCAATACTTCCGCCAAGCGAAGTGCTGGCTCTTTGTCGAGTACCCTGTCAAGGTGGAGCTGTGGCCCGGCAGCTGTTCAGCTTGGGGCGTGC
CCTTGAACAGCACTGCATCAAACGCGAGAGTGGTGGGTTCGTCAAGAAAGCGGTTGCATGCACGAAGGATGATCTCAAGAAGATGACAACCTAGCTGTAT
TCAACGACCTGTTGTGCATCGGACTACCAAGATACATCACTGTTGTGTCTCTAGTGGTATCTCTTCGGGCGCGCTTCGGACCTGACCTTCGTCCGGTAGC
AGCAGCTCACCATCGGTGCTGGTGGCGTGTTCTTTATCCGCTTCATCCGCGTGAAGACGTCAGACGAGCAGACGCTGTCGCTCTTTCCCGACGAAGACTT
CATGACTTGCTCGCTGCTGGCGCTCGCTCTGGCCTTGATCACGCAGGAGTAGCCGTGCGCAGCGCTGCTCAATAACTTGCCATCGCAGACGAAGGACGTC
CCTGTTGAGCTGACCGACTCGATCCCATTGCCGGACCTGCTTGAAGACAGCGGCGCCCTAGATTCTTCTCAGACGTCGAAGAGAAGCACCGCCGTCCACA
CGACACCGACCGTCGGAGTCCACGCTCTTGTCAACCGCTTGCTCGATCGTATTGTTGGCCCAGCTGGCGTCGAAGAGCCGCTGACCTCTCATTCGTTCCG
ACGTGGCGGTGCGCAGCATGCGAACGCGAGGTCAGAGTTGACGGCGCAGTGGATATTCGACCGCGGAGCCTGGAACTTGACCACGACTAACAAAGCCTTC
GCATACGTCTTCAATACTCCAAAAGAAGATCATCAAGTAGCCAAGGTGCTGAGCGG