Description :
From Genome Similarity Track
Location :
Scaffold_831:4118- 9556
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_831-snap-gene-0.8Leucine Rich Repeat Protein Kinase
Pytiw_DAOMBR242034maker-piw_contig_831-snap-gene-0.6Protein HIRA

Sequence
5438 bases(100 bases per row)
CGAGATGAGGTGGCAGCGGCCGTTGCGGCCGAGAGCCTTGACCTCCTCTGGCAGGATCTCGCCGTTGATGGTGTCGAACTGGTTGCCCTGGATCTCCCTG
TGGCGGCACACGGGGTCATAGCAATAGAGCGTGAGGTCAGATTGTGTTTTGCAAGCACCAATGCAAGCAGAACGGAGCTGCTCGTGCGTACAGGTGCTGC
AGGAGCGTGAGCTGACTCAGAGACGCGGGAACGAGGCCAATGAACCAGTTGCGGTCGAGACGGAGCACCAGCAGCCCTTGGAGCAGCGACAGCGTGTCTG
AGACCGGACCTGTGAGGAAATTCGAGCTCAGGTCTCTGTTCAAACATAGACAAAGGCAGTCAGGTCAGTATCAACATTGGCTTTGAAGGGTTTGAGCTCT
TACAGTTCCTTCAGAAACCGGAGGCTTGAACGCGCAAACTCGGGTGGGAGTGAGCCCACGAGGTTGTTTTGCGCCAGGCGTCTGGTGACAGCAGACAATT
TAAAACAATACGAGTGAGTTCAAGGTGAGGACAGAATTTGAGATGTTGCCTAAGCCCAGAGCCACTCACATGGCCTTGATGTGCCCTGCTCGATCGCACA
CGATGCCGTACCACTTTGCACAATACGGCATACATGTCACCAGTCCCACTAAGTCATGTATCTATACAGCAGCGTCTCGCAGCATCCAGGCACCACCCAC
CTTGTTCACGCACGGGTCGCTCATCTCGTTCTGGATGTCCCATCGCTGCTTCCAGGCGGGGCCCTGGGTCGCCCAGTAGATGATCTTGAGCGCACCTCGC
TCGCTACGACTCGTTCCTACGACAGAGACGCCAGCAGTCACCTCTACACTCATATTTGCCACGACGCTGAGCAGCGACAGCAGCGACCAGAGCTTCATAC
TGAGCATCGTGCGTTATGCTTCTGCTTTCGCGGACATCACCAAATCAAAGTACTTTTCTCAGCTCCTCATCTAAAAATAGCAATTTGTTTTCTATTTGGG
GATCGACAAAACCAATATTTATTTTGGGTCCATTTCAAGAATGACTTGAGTTTTGTATTAACGCGTTTCCATACATTTTCAAGATTAAAGCTACTGCGGC
TATTTTTGAAAAAAAATTAAGATAATTCGATAAAGTACGATTTCGGAATGACACAAAACACCTCCAAAAAAAACTGGTGACGATGCTGCTGGAAAAGCCC
GAAGACGTCAAGCACGAGAGCGCGTCGGAGAACAGTGCGCCACCTGCGCTTCACGTGCGCCATCTATGCCTTGTGGTGCATGCGCTGACGTTTTTTTTCT
GTCTGTTGATGTCATTTTTATACGCAGCATGCGCGATCTACGGCGTCGATGCGCATCCGAGCTACCAGCTCTTCGCCACCGCTGGAGGAGGTGCGCTCGT
GTTGTTCGCTGTGTGTGTGCACGTGGCTCCGTGTGCTCACAGTGTGGCTGTGTATCTATTTGTTGGTTCTCTCTCTTGATAGACAACTCGGTGAAGATCT
GGTCGCTGGAGCCGCTGGAGGGCGGTATCGCGACGTTTGAGCTGCTCGCGACGCTCGGTTTCCACCAGCAGGCGGTCAACTGCGTGCGCTGGGCGGGGCA
TGGACGGTTCGTAGTCTGCGAACCTGACCAAGGCTTTTTAAAGTGTGTACTGTACTTACCATGTCATTGCTGTTCCTAATGCACTCGTGTTGTTGTTATT
GCTCAGTTACCTCGCGTCTGGCTCGGACGATCAGCTCGTGCTGCTCTACGAACTGCACCCGGGCGCGCCTGCGCCAGTGCCGTTCGGCTCGAACGCAAAG
CCCAACAAGCAGAACTGGGTGCGCTGCTCCACCCTCAAGCGCCACACCATGGGCAAGCGGTCGCTTTGTTCAATGCCTCACTATTGTCTTGAGGTGTATA
CGACTAACTGATTGGCTCGCAATCGTATATATTAACAGACGTGCAGGACGTGGCCTGGTCGCCGGACGACCGCATGCTCGCGACGTGCAGCATCGACAAC
ACGATCCTCGTGTGGGACATTGGCGTTGGCGGCGTGAGCGCCGTGATGAGCCAGCCGCTACGCACGCTCGTGGGCCACACGGGCTGGGTGAAAGGCGTGG
CATGGGATCCTGTGGGCAAGTACCTCTCGAGCGCCGGCGAGGACAAGACCGTGCGGCTCTGGAAGGTGGACGACTGGCAAGAGGCCGAGGTGATATCGGA
GCCCTTCGAGGCCTGCGCGTCCACGTCGCACTTCCGCCGCCTCTCGTGGTCCCCCGACGGCTCTGCGCTCTGCGCGACCCACGCGTTCAAGTCCAAGAAA
AACATCGCGGCCGTGCTGGACCGCGCCACGTGGTCGAACGATGTCAAGTTCGTGGGCCACCAGGGCGTCGTCACGAGTGCGCGCTTTAACCCCAAGCTGC
TAGGTACGGAGCTCAATCTTCATCTGCGCAGTGTGTTGTGTGGCTAACACTGTGATTCGTACCGCCACGTGTAGTGACCGATGCCACGCCAGACCAGGAG
TTTGCGTGCTGCGCTGTCGGCGGCGATGATGCGACGGTCAGTATCTGGCTCGCGCACTCAGCCCGTCCGCTAGCGGTCGTGAAGGACTGCTTCGATGCAT
CCGTGACCGATCTCTCATGGTCGGCGCACCAGTCGATCCTGCTGGCGTCCTCGCTTGACGGCTCGATCTGTTGCTTCTGCTTCGAAGAGGGCGAGATGGG
CCACCCGATCTCGGACGTGCGCCAGAGCAAACTGCTGCAGGCTAAGGTGTGCAGTCTGTTTGAGTATTGTGATTTTAGGTGGTTATAGAAATATTAACAT
TGTGACTTCAGTATGGCTCCCGTGCAGGCATTACGCTCGCATCGACGTTGGTTGAGAACCCGATCCAGCTCCAGGTACAGTGAGACACACGCATCAGCAT
GTTGTGAAGAATCGTAGTCACAATACTAATCGCGGTCCTTTGTGCGTTTGTACGTCTCTTTTCTGTATCCAGCTCGAAGAGAAATCGGTGGCGTCCGCCA
AAGCAGCGGCTCCTGCTGCAACACAATCGCTTTCAAACGGCGTCAACACGCTCGTGCCGAAGAGAAAAGCTGGTGGCGGCATGCCGCCGCGTCAGGCGGT
CAACATTCTGCAGCCGACGCAGAAAAAGAGCGACAAAAAGCGTATCGCACCAGTGCTGTTGGCAACGAGCAGCCCGGCGATGTCTGCCCCTGTTGTTCCC
AAGACGGAAGCACCACCTAATGCTGCGTCGAGGGAGAACCATATTCGAAACATCCTCGGCCCAGTCGTGTCGCCGACAGTGTCGGACGTGCAGCTTTTGG
ACGCACGGATGACTGGCGCGTTGACCAGCAGTGCATCTCCCCAGGATGACGAGGAGCCACTGTCGTCAGAAGCGGAGAGAGACGACGGATCTTCAACGCC
AGCAGGTCCAGTCGTGACTTTGGTGGCGCCTTCGAAGAAAAGCTCCGAGCCGTCACTAAAGCGCAAGCGTGATGGGGAACGGATCGCTGCTGCTAATGCC
GCCGCACAAGCTGCTGTGGCGTCCAAGGCGCGAGAGATGGCGCCACGGCAGCCAAAATTGCTCAACAACAGGTTTGTTTTTCTATGGCGTCGCATATGAC
GGTTGGATCTCCACTGACTCTTGTATACCTGTTTGCTTGATGTGCAGCGAGACCGTCACAGCAAGCGGTGTGCAGTTGATGCCCGAGTTCCCCCTTCGTC
TGCAGTTCACAGCGGAGATCGACATCTCAGGTAGTAGCAACACACGTGCTGGCGCTAATGACGACATGCCATCCACTGTTACTATTGAAGTGAACGTCCA
CAACGTCAAGAGCTCGCAAGCAGAGGAGACGATTGGTGCGTGCCCTACTCTTGCCTATCTGCGGTGGAGACAACTGGTCTAATACTGTGATTTCGATCCA
AATTGGCTGTCAATACGTAGAGCTTGGACCCGTGTACTCGAGTGTTCAGTGTTCCGCAGGCGGCAGCATCAAGTGGATCGACCGCATCCCAGGCCGCATC
GTGAGCGTCGTTGGCAATGCTGTATTCACGGCCATTGGCGTGGACAATGGCGATCTGTACATCACGAGCCCAAGTGGGAGGCGGCTGTTCCCGTGCATTG
GTGAGCTCTCAGTTCTAATGACTAGTTTATCATCTGACTTCAATGGCTCTAACTTGTCAGTTTGTCTTGGATCGTGTGCAGCACTGGGAAGTCCGTTTTC
GTTGCTCGAGTGCAGCCCGAAACAGTCGTCATACCTGCTGGTGATCCTCGCGACCGGCGCCTTGAAAGTGTGGCACGTGGGCAAGCGCAAGCTCGTGCTA
TCCGAGTCGATTGAGGCGATCACGAACGTCGCCGACACGAATGATGCACGCAGACTGACGCTCTTGCGATGCCACATCACGGTCAAGGGGCAGCCGATTC
TGACGTTCGCCAAGGCCACGTCAGACAGCAAAGCGGCCTCGAGTCTGATCTCGTACACGTTCGACCTGGCTATGGGCTGCTGGTACGTTGCGGGAGGAAC
TTGGTGATATTTAGTTGCTCACATGCATGACTGCCTGATGCTGAAACAGGATGCGCGTAGCAGACGACAGCTTTGTGTTCTCGGACTTTAGCTCCTCGCT
GCCAACGGATGCGGTCGCCGTCAAAGACATACCGGTACGAACGATACTTAGTCTTCCAGGTCCAGTATCATGGTTGGCACTGACGCACTTCTTCTTGTAC
ACGTCAACAGATTGGACCGCTGCGTCGATTGCAGAACGCGTCTGGGTACAGTCGCACGCAGCGCGGCATCGCATCCGCCCTGCTAGGCGGCATGACCGAC
GCGCTCACGCAGCGCAACGTGACGCGATCGCACTTGGAGCACCAAATGGTCGCGTCCATCTCGCTGAAGAGCCCAGTCGAGTATCTGTACTGGTACGGGT
ATTGTGATTTAGACTTCTGTTCGAATCACTGTCGACCGCTGCTCTAACCTCTGATGTGGCTACGGTGGACAGGATCCAAGCGTACGTGCGGTTTCTGGCG
CAAGATGAGGACGTGGATCGCCTCGACGACCTCTGCGCAGACATGATGGGACCGTTCCACGCGTACGTGCTTGTTCGTTCTCTGACAGTTGACTGCCACA
AATAAGACTCACAGTGTCCACTTCTATTTGACTCTTGGCAGCCCATCATCCACTCAAGCGAACGGGAAGTCAAACGACTCCTTGGCTGCTGAGGAGTGGA
ATCCCGTGGTGCTAGTACGTGCTGCTACAGAGTTGTGATACCTGTGAAGGGCCATACTGACAGCGTCGGATTCTCCATTGTGTGTTCACTAATTTCTACA
GGACCAGAACAAGCGCGAGATCCTGAAGACGCGGATCTTGCCGACCATGGCGACGAACCGCACGCTGCAGCGCGTCGTGACCAAGTACCAGCTCATGCTG
AGTGAGATCACCGCCCGCGAGGCAGACTCCGGGAGCGA