Description :
From Genome Similarity Track
Location :
Scaffold_721:4117- 6432
Transcript NameFunction/comments
Hyaar_Emoy2814468hypothetical protein

Sequence
2315 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCCATGAACTGTCGAAGACGCGACCGCTGTACTAGCAGGAGGCGTCAAGACACTAGCATTCTGTGTCGTATTCGTTTCATCACGATG
CACACGCTTAGTGGTCGAAGATGTGAGCGTCTTCTCAGGCAACTCACCGTCCTTCCCACGTTTAGATGGCATTCAAAAGCCGTGCGGTGTCGCTCAGATA
AAGACCGCACTCACAGGAAGTTCAGACAAGCAAGCACAGATGACGAGCAGCACGTCTTTGACGGCTCACTCTCAAGTGCATCTCCTTCGTCGCGTTTTTC
ACAGAATGTTAACAATCGTTTTGAAACGGGGGTGGTTTAACGGGGTCGAACCGTTGCACGAGACTTTCCGTGTAAAGGCACGGAAAAGTCTGAGAAAGGT
TCTAGGTGCGGTACGCACTTAGACCTTTCATGTGGTTGGGGTACAGCAATTGCGTACCTACCACAAGTGTGTGTCACACACGGATGACGTCACTACTTGA
CGTCATTACATGATGTCATTGAAGTACGTCATCAGCGCGCTTATATACAGTTTAAGCGCGCTGTAGAGACGGCGTCTCATCAGAGCGTGCGTCTAGTCTT
TTGTCTTTTAGCCAATAACAATTTAGATTTCTGTTTAATTCATTAAATAGAAATCATTCTTTAATTTGCGATCTTTGTAACGAGTGGACCGGAGGACGGG
AAACCGCGTCCGAGCCACACCGAACAATAAGCGTTCATCTATCGGTGAGGCATTCGTAAGACGCCCAACTGAACCTCGCTGCACGCGAGAGAAGACGGTA
AAACCGCTTTCTCGCAGGTGCCTAAATGTGTGTGTTAAGGTAGTGCGTGGAAGCTTTAAGCGCTCGCCTACAAGAAGAACTTGGTAGCACTAGTCCTTCC
CACGACCCGTCTCTCTGTGAGCGTTTCAGTGAGGATGAGTTTCAATGTTGATTGCACTCAATTCCCCACCTCTTCCAATATCAGAGGGAGGTGGCTGAAC
ATATGGCTCAGGGACTTGATGACCAAGCCCTTGCTAATTTGTCGAGTTGCTCACCAGAGCAACGTGTTCCTCAACTGGAACAGTTTAAGAAGTTCGTGCT
CGGACAGCGGATGTCCGCGTCCGAGGCACAAAGTCATGAAGTGGCGGAGTCCATCAGTAAGACTCATGATGAGCTTCTGCGCGAGCAGGCTCGGAACGAG
GCGCTCAACAGAACTGTTGAGTCGCTCTCGGCCCGGTCTATTAAGCCGAGGCCTATTAGGATGGACCCTCCTAAATTTGATGGCACTGCCGTCCGCACTA
TTGTACACTGGCTTCTAGCCGTTGAGCAATGTGGTGTGGCGCAGCTTATCGAGGACGATACCAGAATGGTATCGTACGCTATATCCCATTTGCGGGGTAA
GTCCTCGAAATGGGCTTACTCAGCGCTTATGGCCAACAGTAAAGCGTTTTACACCGATCGGAAACGGAGTTGGTGCTTTGTGTTGGTGCTCTTCATGAAG
TCGAAGGAAGCTGTTATTGTGAGCTCTGACGACAAATCTACCGTTAAGAGCGTCCTGTGTAGGAATACTGGAGTTGTTGCGAACGGATGCATCTACGATG
CGTCTAAGCGAAATCCGCTCTTCTCATGGGCGATCTTTAAGACAAAGATTCGCGCCATATATCAGCCGCCGAACAACGAAGTGTTACTTCGAGCGCGCTT
CTTTAGCAAGCGCAGCGATCCTTGCAAGACTATGTACAGGAGGTGTGCTCTCTGTCGGCGTCTGTTAGTGTGGTCCGATACCGGAAAACATTAAGGTGCC
CACGTCCCTAAACGGACTGCGACGTGGCCCAGCGCGACATGCCCTTTTCATAAAGGTGCCGTCGATAATGGAAGAAATTGGGATTGCTTTAGTTGAGGAG
CAATCCTACAACAGTGCTTCAGTAACGCCTTGGCAAAAGCCGGCAATCGAAAAGTCTGCAGCCACTCTAATGGATTTGGGCAACGCAGATGTTGTCTGCT
ACAATTGCGGAAAGC