Description :
From Genome Similarity Track
Location :
Scaffold_41:411589- 415241
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012248Similar to GP1: Vegetative cell wall protein gp1 (Chlamydomonas reinhardtii)

Sequence
3652 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAG
CGACGCCATGATCTTCTGGAGGGGAGTCTTCGCGAGAGTTCGTCCAGTGTCGATCACCATGTCGTACTTGGCACGAGGGAGTACATACGGACGCGCTTGT
TCCATGCGAGGGGCAATGAACGACCAGTCACTGCCAGCGGCGTACTGTCGCTCAATCGCTTCGATGTCACAGGCGAGAGGCTTTGGGGTCTCCACACGAC
GGCGCGTAGCGTCCGCATCAGCATTGTCGCGACGGAGGTGTTCTTGTTGCGCAAGCACTTCAGCCATCGTCGGACGCGGGTCCACACTAGGAGGCGCGGT
GACGTTGGGAAGGTGCTGCGGGGGTTCCATCGGCTCATCGTCAGATGCAGCGGCGTCAGGAGGCGAGACGGTCACATTCGACGGAGTTTCCATCGGCACA
TCCATTTCGTCGCTCGTTCCAGTCGGCTCACGAGCACGTGAAGCGGATGGCGCAGACGAAGAAGGAGACGGAGGCACGTCGGGCTGGGAGGCTGGAACGC
TACTCGGAGGAAGAGGTCCAGACCTTTCCAAATTTTCCGAGGGAGATGGGCCATGCGAGGGATCTAGCTGGATACTGGGTGCGAACCCAGATTCCAGACC
AGATGCGACACGTGGCAGCTGCTCGGAAGGAAGAGAAGAGGCGGAGGCTGGATTTTCCATGGGGAAAGGCGGAGGGAAGGCGGCGAAAGCGGCGGCGGTG
GTTGGCTGGGTTCTTCTGAAGAGTCGACTTGTGGGGTAGCCGGCAAATTGAGAAGTGGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGA
GGTACTGGGATCGATACCCAGCTTCTCCAAAATGGTTCTGTTACTGTGATATGACCGTCAGCAACAGCACTTTCCCAAATGTGCACTTCGCAGTCTCACC
TGTGAATTCGTTGACATTGAGTAACAATCAATCTTTTTGCTGCTGCATCTTGCCTCTCCTCCTTTGCCCGGCTACAAGCCTCCCACTCTTGTAGATTAGA
TTACGCGTCACTATATCCACGCACGCATCCATGTGGTGAAGAAGGCATGTAGCCATGAAATACACGTTCTCTGCTCCAACTTGCATAAGCTACTGCGAAA
TATCTTGTGTGAATGTGCAGTGCACGTGTGTGCTGCGTACGCATGCGCATGCGCGTTGCGTCTGACTGCAATGTGTGAGTTTGTGTGTTTGCGGTGGTGA
GCACGAGAAAAGAAAAAGAGTAGACAGCACTCGGACTTCCCCGGTGGTCACCCACCCGAGTACTACCCGAGCTTGAGCTGCTTAACTTCGCAGAGCGAAC
GGNNNNNNNNNNNNNNNNNNNNGACACGCTCTCGGGGTCTACACCTATCTACGATAGCAGCGGAATGCGTTTGGTAAAACATCTGGGGGTGTCGCGGGTG
ACCCCAGGCCGCCAGGTCGCAAAAACCTCCACAAATGGATGAAATGGCCATTTTGGCATGAAAACGCGCGTTTGACCATGACGCGTTTACAGGAGACTTG
ATACGAGTGCACAAGCGTGTTCCCCGTGTGACATAACCCCTATGCTACTCCATTGCGGGGGGTCGCGATGTCATTTAGGGGGTTCAGTGAGTCGCGCCGA
CGTTCTGAGTGTGTGCGTGTGTGTGTGCTGCGGTGTTGAGTCGGTGGTTCTGTGATTGTGTGATTGTGTAATTCGGAGGAAAGAAAAAGAGTAGACAGCA
CTCGGACTTCCCCGGTGGTCACCCACCCGAGTACTACCCGAGCTTGAGGCTGCTTAACTTCGCAGAGCGAACGGGATACGGTGTTCTCAGCCTAAGATGG
CCGTCTACATCAACTCATATCTACACCCGCTACACATTCATTTTACAAACACCAACCACTTACTTCTTCTTCTTCTTGCCTTCCACTCTTACAACAACAA
AAACAACAAAAACAAAACACACATCTCTCCACATACCTTGCATATTTGCAGCAGCAGTTCCCCCTGGCTCCTTGGCCCGAAACAGAATGCACAAAGCTCC
ACAAATGGATGAAATGGCCATTTTGGCATGAAAACGCGCGTTTGACCATGAC