Description :
From Genome Similarity Track
Location :
Scaffold_112:41158- 42897
Sequence
1739 bases(100 bases per row)
AGCAGCAGCGGTGGGTGAATCATACATTCGGAGAAAAACGGACGTCGGTGACGCAGCAGGCTCGATagTTTGTTGTCTAAAGTCAGTGGAGTTGTCTGCC
GATCCCACTTCTTCAGTATCAGTGTAATGGCTTCGTAGGTATGAACGGCGCATGAGTCGAATGTGCGTTTTTGTCTCGGATTGAGATCGTTTGTGCCCTG
ATTGGGCATCACCACCACTcAGTTCCACGAAAATGCCAGTTAAACTCATGACCAACACCAAGCTGGGTAACGTCATGGGAATGACGACACACATGGCAAG
AAAAGGCAAGAGAACCATGATTGGGATCAAATAGTACCCCGAATCTGTGCTAGCAACGGTTTGCCACTCtACCAGAGAAAACCAAACAAGATAAAAGGCT
TGTCCAATCGTAGCGAAATGGAAGAGTCGTAGCAAGAAGCGAGGGCTATTGAACCAGAACCGATCATTGTGAAAATGAAGCTGTCGGTGACACAAAGCCG
ACATCTGCATTCTGATGATTGAGCGCACCCCCAATGCAACAACCCGAAGGCTGGGTCGGTGTCTCACCGCAGTCTCGGGCTTGTCGGAGCGATTCAGGCG
TTGTAGACGTCGTTGGATGTCTTGGGTCGTGATGATACGCAGACGGTCATCAACGATCCCGCGCAAAATGTGGAGTGTCTTGAAGAAGATTAGCAGGTTC
GCAAACAGAAGTAATGCACCAACGCCGATAAAAATCCAGTGGTCATAGTCGGGATATAAGACTGGGACAACGGCCACGATAAGGAGCACGAAGAATGCGC
TGAAATGCAAATGCGAAATGTTGTACAACAAGTTCCGCATGCAGAGAATATGATACTGGTGGTATGTCATTCGCTTgaTTGATCCGTCTTCATGAAACTG
GGGGAGAACACCAAATAGTCTTTCCATCTCTGAAGGATTCTTGTAGATGTATCCTGACCGATTCTGGCATATGTTGTAAGCCAGAATCTCAAAGCTTCTC
CACAAATGCCACTGCTTTTTCAAGTTGAACCTGAAGCACCAACCTTCGCGTTGATACCGCTGAAGTAACAATGAGTATGCTCGAGATCCTTGCACAAGAT
CCATGCCTGAGTTCGCTCGACCACGCAGCATCGCTTGTCGATGCAATTGACGTGTGGATATTATCGACGGGAACTCACGACGAGAGAGTCGATCATCAGA
TGCGTTGATTGTATCATTTGGGTTCTGACTGTGTCTGTTCCACGAGCGACAGTCTTCGATATTGTCAGTGTCCTCGTCATTGCTTTCGTTTTCATTCTCG
GACTCACTGTCGGCATCGGTGTTTTTAaTTCCCAGATGAGTTTAGGGACGACCGTACCAACGAACAACAAGAAGAGCACAATCAGGATGAAGTAGATCAT
CGATAAAAaCACAATGTAGTGGAAGAACTCGTAGAAATGCAGCCGTTCAGAGCCGGAGAGGTCGCCGTCGAAGGCAAAGTGGAGCTTCTCAATGAGCCCA
CTAGAGTTCAACGTGAAGATGATCATCGAGATAAACCCCATGATCATCACTTCTTCAAAGATTCGGTTGACGATTTTCTTGAGCTGTGGACACTGAATCG
CACGGCgcACGGCATGAaTCGCGtGTTCAAACACTAGCGAGACAATGATAATGATCGCGAGCAaGAAAATCGCAGTGCCGAGGTTATCATGCAAACAGTC
AACGTTGCCCAcGCCCAAGAAcGACCCTGATTTGTGGCA