Description :
From Genome Similarity Track
Location :
Scaffold_185:4115- 5204
Transcript NameFunction/comments
Albla_Nc14093450conserved hypothetical protein

Sequence
1089 bases(100 bases per row)
CCCAGGAAATGTTAAAGGCCCAGATCCGACAAGTTCAAGCTCGTACGTCTTTAACCCCAAAAGATAAGGCCGAACTCGTGCAAGGACTGATGATGAAGCA
GTGGAATGATTCTCGACAAAAAATCATCGCGTTGAAAGGCTCTTATGACACCGAAACGGAGCGTCTTCGGCCAACCTATCATGTTCGTTCCATGCATCCG
TTGTGATCCAATCTAATACTGATGCTCAAGGATAAGCTCAAGTCTATATCAGGCTGTCAACATTACCAGTATGTTAGAGGAATCACGCACATTGTTTGTT
TACCCTGACTCATGTAGACGCCGATGCAAGCTCCGAGCAAAGTGCTGTGGCAACTGGTACACTTGCAGATTTTGTCACGATGAGAATGAGAGTCACAGTA
TCGATCGATACGCGACAGAAGAGGTCTCGTGTATGTGTTGTGCCACGATTCAGGTTAGCAATCTACTCCGTCACGACCTCTTTTCTCTATTAATTGAATA
CGTGACAGCCGGTCTCCAACCGATGTGTCGATAGCTTGTGTGGAGTCGAATTCGCACGATATTTTTGCGGTACTTGTAAATTCTACGATGACGACGCCAA
GAAAGATATCTATCACTGCGACAAATGCAAAATTTGTCGAATTGGGAAGGGATTGGACATCGATTACTTCCATTGCGATCGATGTAACGCGTGTATGAGC
ATCAGTTTAAAGAAGCACAAATGCGTCGAGCGCTCTTTAGAATCGGATTGTCCGATTTGTCACACATTTATGTTTACATCGACAACACCGGTGATGTTCC
TTCCCTGTGGTCACTGCATGCATGTAACCTGCTATGAAGAGTACACGCTGGTACGAATATTTGTATTTGACTCTATGCGGAGCTAACTTTTTCCCAGTCA
AATTATGTCTGCCCGTTGTGCTCGAAATCGCTGGGTGATATGGAGCTTTACTTTGCGAGTATCGATGAGTTACTGGAACGCGAGCAGATGCCGATAGAGT
ACGCCCACGTTCGATCTCTCATTTATTGCAGCGATTGTGAACGCCGTTCAGTCACGAAATTTCATTTTGTGTATCACAAATGTCAGCAG