Description :
From Genome Similarity Track
Location :
Scaffold_1090:41122- 42898
Sequence
1776 bases(100 bases per row)
GTGCGAACTCGGCTAGCGGTAGGAACGAGCTCCACTGGAACTTGGAGGTTGGTAACGATTCACCAGCTCGAGTTCCTCCTCTAAAAATCCGGCTAAAACC
TGGTGCAGCTCCCTACCGGTGCAAAGTACGTCAATACAGCCCGGAAAAATCAGAATTTATCGATACTTTTAACAAGAAGCTTGTCGAATTAGGGTGGGTT
TATGAAAACCGTGAGAGCCGCTGGTGCTGCCCAGCCTTACCGGTTAAAAAGCCCAGCACTGATGACTACCGACAAACAGTGGATTATAGACCGACAAATG
CTCTTACCGAGTCTATCGCTGGTGTGATGCCGAGTCTTGAGGTGCCTTGGAACACTGTAGAGGAATGATGTACTACGCGATGTTTGACTTCCTCAAGGGC
TTTTGGCAGCTCCCATTACACGAGAGCTGCCGTGAATTTCTTTCGTACATGACCGACCGCGGCGTGTTCACGCCAACTCGGGTTCCACAAGGAAGCACCG
ACGCTGCCCTACACTTCCAATCGACGGTGGAAATGGTTTTAGGTGATTTGGTGAACGCGAATGCCATCGTGTGGATCGATGACCTCCTCGTTTTTTCCAA
AAACGCTGATAAATTGGTTGAAATTATTGATGCCGTACTTCAGAGGCTGGACGAGTTTGGATTTATCCTAAATCCAAAGAAGTGCTCTTTGTTTCAAACT
GAGGTCCACTGGTGTGGCCGCATCGTCAACAAGGATGGAATCGGTCATGACCCGAGCCGCATCCAGGCCTTAAGAGATATGCCACCGCCAGCGACCGCCG
CCGAGCTGCAGCAATTTCTCTGCGCCACCAATTGGATGCGCGCAAGTCTAGTTGACTACGCTCGTGTCGCAAAGCCATTACAAGAACGTCTCGACGCAGC
CTTGGTCGGTACTAGAAAAACCAAGAGAGCTGCAGCAGGGGTGCAAATCGATTTGACAGTGGAGGAATTGAAAAGTTTCGATACAGTAAGGGACTTGTTG
GCACATTCGGCGACGTTATCATACCCAGATCCAACCAAGCAGCTAGTACTGATGTCTGATGCCTCTGATTCTGGCTGGGGTTTAGTTGTATCGCAAGTGA
GTCGATGGAAGCCGCAGATTCCGATCCACCAACAGGACCCTGAGTTGCTGGTCTGTATGGGAGGCAGTTTTACTGGCTCAGCTCTTAACTGGAGTGTTAT
CGAGAAGGAATCATTCCCCGATCGTTCACGCGTCTGAACGACTGGAATATATATTGCTTCGTCCACAAGGGTTTAAACTATACTGCGATCATCGGAACAT
CGTCTACCTTTTCGCTGCCGGCAAAGAGTTAAAGAAGCATGTGCGCGGAAAACTCTTACGCTGGTCCATTAAACTATTAGAGTACCCGATACTCTATAGA
GCACATTGAGGGGATTCACAACGTATGGACGGACCTGATATCGAGGTGGGGCGGCAAACCCCTAGCAAGAGCGCGTATTCACTCGGCCAAGAGGTTCACA
CGAGCCAATCGCAAGCGTGGAAGCGGTTCAAAGGCGAGTCCAGCGCCTCCACCGCTACGCCCACTAGACCAGGACGGTTTCGTCTGGCCTACAGTCGAGG
AGATTGGTAGCGTGCAATCACTGCACGACGCAATGAAGGGTGCAACACTGAGTGGTGATGCACTATGGCTTATGAATGACGTGATTTGGATACCAAGTGG
AGCTCACGACTTGATTCAAAGACTTCTCGCCGTCGCGCACTGTGGTAGAAACGGACACCGCGGCATGCATGTGATG